\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627106092:

Variant ID: vg0627106092 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27106092
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGAGGTCTAACCCCACGTTTGTTCGGAGCTCTCAACCACCCCATACGGCAACGAGATCCAGGGGCCACCGTCGCCGGCCGTATGGCCTCGGCTAATC[T/C]
ACATCGTCCCCAATGCACCTCCTCCCCCAAACCCTAGGTCCCCACACCATGAGGGACCACCGTGTCCCCCTCCGTGACATGCGGGGCGCTACTCAACGAC

Reverse complement sequence

GTCGTTGAGTAGCGCCCCGCATGTCACGGAGGGGGACACGGTGGTCCCTCATGGTGTGGGGACCTAGGGTTTGGGGGAGGAGGTGCATTGGGGACGATGT[A/G]
GATTAGCCGAGGCCATACGGCCGGCGACGGTGGCCCCTGGATCTCGTTGCCGTATGGGGTGGTTGAGAGCTCCGAACAAACGTGGGGTTAGACCTCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.40% 0.06% 0.00% NA
All Indica  2759 91.90% 8.00% 0.11% 0.00% NA
All Japonica  1512 4.10% 95.90% 0.00% 0.00% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 89.70% 10.30% 0.00% 0.00% NA
Indica Intermediate  786 88.90% 10.80% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 9.10% 90.90% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627106092 T -> C LOC_Os06g44840-LOC_Os06g44860 intergenic_region ; MODIFIER silent_mutation Average:66.02; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627106092 9.53E-07 NA mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 1.31E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 6.64E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 1.12E-32 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 7.71E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 2.07E-28 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 5.77E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 1.64E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 8.56E-33 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 2.46E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 4.43E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 2.01E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 6.70E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 1.28E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 9.17E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 2.45E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 5.94E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627106092 NA 3.02E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251