\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627047035:

Variant ID: vg0627047035 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27047035
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 27. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATATCTACATAACCAATTTAGTTTCGCTAAATGTAATATTGAATATATTTTGATAATATATTTGTTTGGGTTGACAATGTTGCTATATTTTTCTAT[G/A]
AACTCGGTCAAATTTAAAGAAATTTAACTAAAAAAAACATCAAAATGACTTATAATATGAAACAAATGGAGTAGCTGACAATGGAACTAGTTAAAAAAAT

Reverse complement sequence

ATTTTTTTAACTAGTTCCATTGTCAGCTACTCCATTTGTTTCATATTATAAGTCATTTTGATGTTTTTTTTAGTTAAATTTCTTTAAATTTGACCGAGTT[C/T]
ATAGAAAAATATAGCAACATTGTCAACCCAAACAAATATATTATCAAAATATATTCAATATTACATTTAGCGAAACTAAATTGGTTATGTAGATATTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 32.10% 0.06% 1.93% NA
All Indica  2759 96.70% 2.40% 0.04% 0.91% NA
All Japonica  1512 4.30% 91.30% 0.07% 4.37% NA
Aus  269 87.00% 12.60% 0.37% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 96.70% 0.50% 0.11% 2.63% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 98.40% 0.00% 0.65% NA
Tropical Japonica  504 9.50% 79.80% 0.20% 10.52% NA
Japonica Intermediate  241 4.10% 92.50% 0.00% 3.32% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627047035 G -> A LOC_Os06g44760.1 downstream_gene_variant ; 1207.0bp to feature; MODIFIER silent_mutation Average:18.04; most accessible tissue: Callus, score: 42.81 N N N N
vg0627047035 G -> A LOC_Os06g44770.1 intron_variant ; MODIFIER silent_mutation Average:18.04; most accessible tissue: Callus, score: 42.81 N N N N
vg0627047035 G -> DEL N N silent_mutation Average:18.04; most accessible tissue: Callus, score: 42.81 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627047035 NA 4.51E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 6.78E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 6.32E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 2.07E-33 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.29E-39 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.25E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.18E-24 mr1298_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 4.85E-53 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 2.03E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 9.32E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 4.25E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.03E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 8.41E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.58E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 7.83E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 7.54E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.68E-24 mr1731_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 8.87E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 1.39E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 4.78E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 4.54E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 8.79E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 7.88E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627047035 NA 6.60E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251