| Variant ID: vg0626912201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26912201 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCATCCTATTCCTTATCTGTTTGCTTGATCTGTTACTATTTATATTCATTCTCCTTGGAAACTTTAAAATTTTCATTTTATAGTTTTTAGAGTTTATTGT[C/T]
TCATTGAGTTTCGTTTTTATAATTTTTAGAAGTCCCATCAAACATTGCCACTCTATTTCTCTACTGCCCATCCGCTGCCTCCTCTCTTTATTATTATTGG
CCAATAATAATAAAGAGAGGAGGCAGCGGATGGGCAGTAGAGAAATAGAGTGGCAATGTTTGATGGGACTTCTAAAAATTATAAAAACGAAACTCAATGA[G/A]
ACAATAAACTCTAAAAACTATAAAATGAAAATTTTAAAGTTTCCAAGGAGAATGAATATAAATAGTAACAGATCAAGCAAACAGATAAGGAATAGGATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 1.30% | 2.20% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 2.20% | 3.73% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 81.70% | 8.10% | 10.25% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 1.50% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626912201 | C -> T | LOC_Os06g44560.1 | upstream_gene_variant ; 807.0bp to feature; MODIFIER | silent_mutation | Average:25.182; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| vg0626912201 | C -> T | LOC_Os06g44570.1 | upstream_gene_variant ; 2071.0bp to feature; MODIFIER | silent_mutation | Average:25.182; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| vg0626912201 | C -> T | LOC_Os06g44540.1 | downstream_gene_variant ; 4026.0bp to feature; MODIFIER | silent_mutation | Average:25.182; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| vg0626912201 | C -> T | LOC_Os06g44550.1 | downstream_gene_variant ; 779.0bp to feature; MODIFIER | silent_mutation | Average:25.182; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| vg0626912201 | C -> T | LOC_Os06g44550-LOC_Os06g44560 | intergenic_region ; MODIFIER | silent_mutation | Average:25.182; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626912201 | NA | 3.78E-11 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 4.63E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 3.49E-13 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | 1.80E-06 | 7.48E-18 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 3.70E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | 2.97E-06 | 7.08E-08 | mr1268_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | 2.64E-07 | 5.60E-19 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 2.08E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 4.50E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 6.89E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 7.99E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626912201 | NA | 1.13E-06 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |