\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626895745:

Variant ID: vg0626895745 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 26895745
Reference Allele: CATAlternative Allele: TAT,C
Primary Allele: CATSecondary Allele: TAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTGTTTTTTTTGCTCCGATTAATATGAGAATTTATAGGCCGTGAGAGCGAACGTGGATGCT[CAT/TAT,C]
TTTTTTTATTCCTTTAATAAGTTAATAGATAGATATCATAAATTTTAAAAATATGACTCTATTTTTTATTTTTAATTAATGTGTGAATTTCTAGGCCTTG

Reverse complement sequence

CAAGGCCTAGAAATTCACACATTAATTAAAAATAAAAAATAGAGTCATATTTTTAAAATTTATGATATCTATCTATTAACTTATTAAAGGAATAAAAAAA[ATG/ATA,G]
AGCATCCACGTTCGCTCTCACGGCCTATAAATTCTCATATTAATCGGAGCAAAAAAAACAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTC

Allele Frequencies:

Populations Population SizeFrequency of CAT(primary allele) Frequency of TAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.40% 0.30% 0.00% C: 0.02%
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 92.20% 7.10% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.30% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 82.30% 17.70% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 7.10% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 2.22% 0.00% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626895745 CAT -> C LOC_Os06g44530.1 upstream_gene_variant ; 3273.0bp to feature; MODIFIER silent_mutation Average:30.304; most accessible tissue: Callus, score: 42.826 N N N N
vg0626895745 CAT -> C LOC_Os06g44530-LOC_Os06g44540 intergenic_region ; MODIFIER silent_mutation Average:30.304; most accessible tissue: Callus, score: 42.826 N N N N
vg0626895745 CAT -> TAT LOC_Os06g44530.1 upstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:30.304; most accessible tissue: Callus, score: 42.826 N N N N
vg0626895745 CAT -> TAT LOC_Os06g44530-LOC_Os06g44540 intergenic_region ; MODIFIER silent_mutation Average:30.304; most accessible tissue: Callus, score: 42.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626895745 3.48E-06 3.48E-06 mr1065_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.29E-09 3.06E-10 mr1068_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 1.60E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 1.63E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 1.98E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 7.69E-06 2.73E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 3.99E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.25E-09 1.45E-10 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 9.92E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.48E-07 3.31E-08 mr1094_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 4.36E-07 2.77E-09 mr1096_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 2.04E-06 2.03E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 5.89E-06 1.21E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 8.93E-07 6.92E-08 mr1112_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.00E-07 1.28E-09 mr1121_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 8.53E-06 1.66E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.52E-10 3.73E-11 mr1200_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 3.17E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 2.71E-08 2.71E-08 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 1.83E-06 NA mr1241_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 8.15E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 4.45E-06 3.28E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 5.23E-06 4.96E-07 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 8.21E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626895745 NA 1.65E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251