\
| Variant ID: vg0626887934 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26887934 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 204. )
CCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTATCCCCCGACTTCAATGCAAATGAACGAATTCATATTCTCAACTGCGC[G/A]
CAGACATTGGAGTAACTGTTATCGAGCTCATGTGACCGTTCTCGGTGAGTTTAGAGATAACGTTGGACTTCCTTTGTCAGCCTCGTGCGGGCACCGAAAG
CTTTCGGTGCCCGCACGAGGCTGACAAAGGAAGTCCAACGTTATCTCTAAACTCACCGAGAACGGTCACATGAGCTCGATAACAGTTACTCCAATGTCTG[C/T]
GCGCAGTTGAGAATATGAATTCGTTCATTTGCATTGAAGTCGGGGGATACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 36.30% | 4.00% | 0.61% | NA |
| All Indica | 2759 | 93.80% | 2.80% | 3.04% | 0.33% | NA |
| All Japonica | 1512 | 1.10% | 98.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 53.20% | 5.20% | 34.57% | 7.06% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 92.70% | 0.40% | 6.35% | 0.55% | NA |
| Indica Intermediate | 786 | 91.10% | 6.20% | 2.16% | 0.51% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 89.60% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 48.90% | 7.78% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626887934 | G -> A | LOC_Os06g44510.1 | downstream_gene_variant ; 1789.0bp to feature; MODIFIER | silent_mutation | Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| vg0626887934 | G -> A | LOC_Os06g44530.1 | downstream_gene_variant ; 2681.0bp to feature; MODIFIER | silent_mutation | Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| vg0626887934 | G -> A | LOC_Os06g44510-LOC_Os06g44530 | intergenic_region ; MODIFIER | silent_mutation | Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| vg0626887934 | G -> DEL | N | N | silent_mutation | Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626887934 | NA | 4.80E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | 1.36E-06 | 1.36E-06 | mr1417 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | 2.32E-06 | 2.32E-06 | mr1507 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | NA | 5.75E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | NA | 5.75E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | NA | 9.27E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | 3.51E-06 | 3.51E-06 | mr1810 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | NA | 1.41E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | 4.19E-06 | 4.19E-06 | mr1824 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626887934 | NA | 2.78E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |