\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626887934:

Variant ID: vg0626887934 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26887934
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTATCCCCCGACTTCAATGCAAATGAACGAATTCATATTCTCAACTGCGC[G/A]
CAGACATTGGAGTAACTGTTATCGAGCTCATGTGACCGTTCTCGGTGAGTTTAGAGATAACGTTGGACTTCCTTTGTCAGCCTCGTGCGGGCACCGAAAG

Reverse complement sequence

CTTTCGGTGCCCGCACGAGGCTGACAAAGGAAGTCCAACGTTATCTCTAAACTCACCGAGAACGGTCACATGAGCTCGATAACAGTTACTCCAATGTCTG[C/T]
GCGCAGTTGAGAATATGAATTCGTTCATTTGCATTGAAGTCGGGGGATACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 36.30% 4.00% 0.61% NA
All Indica  2759 93.80% 2.80% 3.04% 0.33% NA
All Japonica  1512 1.10% 98.80% 0.13% 0.00% NA
Aus  269 53.20% 5.20% 34.57% 7.06% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 93.10% 5.20% 1.72% 0.00% NA
Indica III  913 92.70% 0.40% 6.35% 0.55% NA
Indica Intermediate  786 91.10% 6.20% 2.16% 0.51% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 89.60% 3.12% 0.00% NA
Intermediate  90 42.20% 48.90% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626887934 G -> A LOC_Os06g44510.1 downstream_gene_variant ; 1789.0bp to feature; MODIFIER silent_mutation Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0626887934 G -> A LOC_Os06g44530.1 downstream_gene_variant ; 2681.0bp to feature; MODIFIER silent_mutation Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0626887934 G -> A LOC_Os06g44510-LOC_Os06g44530 intergenic_region ; MODIFIER silent_mutation Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0626887934 G -> DEL N N silent_mutation Average:25.614; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626887934 NA 4.80E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 1.36E-06 1.36E-06 mr1417 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 2.32E-06 2.32E-06 mr1507 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 NA 5.75E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 NA 5.75E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 NA 9.27E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 3.51E-06 3.51E-06 mr1810 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 NA 1.41E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 4.19E-06 4.19E-06 mr1824 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626887934 NA 2.78E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251