Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0626320718:

Variant ID: vg0626320718 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 26320718
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTATACGGAAACAAACCTCGTATATAGAAGGAGTTCCGGATAAGGAATGACGAGTAGAGTTCTATATGAAAACGACAAGGACTACTCAGATCGTATC[C/T]
ATATTTATCTACTTAGTTCTACTTGGACAAAGGGGCTGGGTATAAATACAAGCCCCCCTAGGAGGAGAGGGGACACGCCACAAAGCCACAAGCCAATACA

Reverse complement sequence

TGTATTGGCTTGTGGCTTTGTGGCGTGTCCCCTCTCCTCCTAGGGGGGCTTGTATTTATACCCAGCCCCTTTGTCCAAGTAGAACTAAGTAGATAAATAT[G/A]
GATACGATCTGAGTAGTCCTTGTCGTTTTCATATAGAACTCTACTCGTCATTCCTTATCCGGAACTCCTTCTATATACGAGGTTTGTTTCCGTATAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	4.70%	0.00%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	34.90%	65.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0626320718	C -> T	LOC_Os06g43710.1	upstream_gene_variant ; 1762.0bp to feature; MODIFIER	silent_mutation	Average:56.048; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0626320718	C -> T	LOC_Os06g43730.1	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:56.048; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0626320718	C -> T	LOC_Os06g43720.1	downstream_gene_variant ; 535.0bp to feature; MODIFIER	silent_mutation	Average:56.048; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0626320718	C -> T	LOC_Os06g43740.1	downstream_gene_variant ; 2110.0bp to feature; MODIFIER	silent_mutation	Average:56.048; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N
vg0626320718	C -> T	LOC_Os06g43720-LOC_Os06g43730	intergenic_region ; MODIFIER	silent_mutation	Average:56.048; most accessible tissue: Minghui63 root, score: 72.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0626320718	NA	3.23E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	3.94E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	3.18E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	4.99E-06	NA	mr1102	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	8.96E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	9.66E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	1.12E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	2.34E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	5.84E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	1.76E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	2.47E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	1.18E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	3.68E-06	mr1474	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	3.68E-06	mr1475	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	1.24E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	2.25E-41	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	8.66E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	1.25E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	8.38E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	8.35E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	2.58E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	6.25E-08	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	3.74E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626320718	NA	2.90E-07	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251