| Variant ID: vg0626294443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26294443 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 222. )
CTACAACAAGTTTTCTCTCGGAGCAGCTTTTAATTGGTTCGTGTAATTTCTTGTCAATTACTCCTTTCCTTTCAGGCTGTCAATTACTCCCTCCGTTTTA[G/C,A]
GTTATAAGACGTTTTGACTTTGGTCAAAGTCAAACTGTTTCAAGTTTGACTAAGTTTATAGACAAATATAGTACTAAGTTAGTTTCATCAAGTCAATAAT
ATTATTGACTTGATGAAACTAACTTAGTACTATATTTGTCTATAAACTTAGTCAAACTTGAAACAGTTTGACTTTGACCAAAGTCAAAACGTCTTATAAC[C/G,T]
TAAAACGGAGGGAGTAATTGACAGCCTGAAAGGAAAGGAGTAATTGACAAGAAATTACACGAACCAATTAAAAGCTGCTCCGAGAGAAAACTTGTTGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 19.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 66.30% | 33.30% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 45.20% | 54.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 59.10% | 40.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 70.50% | 28.90% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626294443 | G -> C | LOC_Os06g43680.1 | upstream_gene_variant ; 2236.0bp to feature; MODIFIER | silent_mutation | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| vg0626294443 | G -> C | LOC_Os06g43670.1 | downstream_gene_variant ; 2098.0bp to feature; MODIFIER | silent_mutation | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| vg0626294443 | G -> C | LOC_Os06g43670-LOC_Os06g43680 | intergenic_region ; MODIFIER | silent_mutation | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| vg0626294443 | G -> A | LOC_Os06g43680.1 | upstream_gene_variant ; 2236.0bp to feature; MODIFIER | N | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| vg0626294443 | G -> A | LOC_Os06g43670.1 | downstream_gene_variant ; 2098.0bp to feature; MODIFIER | N | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| vg0626294443 | G -> A | LOC_Os06g43670-LOC_Os06g43680 | intergenic_region ; MODIFIER | N | Average:51.601; most accessible tissue: Zhenshan97 root, score: 75.661 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626294443 | NA | 6.07E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 3.61E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 5.81E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 6.83E-08 | mr1378 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 3.79E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 1.52E-07 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 2.41E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 3.33E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 7.78E-10 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 5.68E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 2.43E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 2.32E-07 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626294443 | NA | 7.59E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |