\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626188532:

Variant ID: vg0626188532 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 26188532
Reference Allele: CCCAAlternative Allele: TCCA,C
Primary Allele: CCCASecondary Allele: TCCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGGCTCTCTAAGTTAAAATTTGGCTAACTTACACAAAAAAAATCTACTCCAACAGACTAGCCAAATGCCTCTCCAAGCCATCCGGCTGTCTAAATTC[CCCA/TCCA,C]
CCAGACTAGCTAAAGTTGGCCAGCCAAAACCGGCTAGCCATATGTGGGACCCACGCCTGTTTCCCCCTCTCTCTCTCTCCATGCAGCAGTGCGGCATGCA

Reverse complement sequence

TGCATGCCGCACTGCTGCATGGAGAGAGAGAGAGGGGGAAACAGGCGTGGGTCCCACATATGGCTAGCCGGTTTTGGCTGGCCAACTTTAGCTAGTCTGG[TGGG/TGGA,G]
GAATTTAGACAGCCGGATGGCTTGGAGAGGCATTTGGCTAGTCTGTTGGAGTAGATTTTTTTTGTGTAAGTTAGCCAAATTTTAACTTAGAGAGCCATTT

Allele Frequencies:

Populations Population SizeFrequency of CCCA(primary allele) Frequency of TCCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 35.10% 0.02% 0.00% C: 0.02%
All Indica  2759 47.10% 52.90% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.60% 0.00% 0.00% C: 0.07%
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 24.20% 75.80% 0.00% 0.00% NA
Indica II  465 26.00% 74.00% 0.00% 0.00% NA
Indica III  913 65.80% 34.20% 0.00% 0.00% NA
Indica Intermediate  786 55.20% 44.80% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.00% C: 0.20%
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626188532 CCCA -> C LOC_Os06g43550.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> C LOC_Os06g43550.2 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> C LOC_Os06g43560.1 downstream_gene_variant ; 1439.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> C LOC_Os06g43550-LOC_Os06g43560 intergenic_region ; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> TCCA LOC_Os06g43550.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> TCCA LOC_Os06g43550.2 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> TCCA LOC_Os06g43560.1 downstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N
vg0626188532 CCCA -> TCCA LOC_Os06g43550-LOC_Os06g43560 intergenic_region ; MODIFIER silent_mutation Average:95.299; most accessible tissue: Zhenshan97 panicle, score: 98.935 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0626188532 CCCA C 0.31 0.14 0.26 0.37 0.5 0.47
vg0626188532 CCCA TCCA -0.02 -0.02 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626188532 NA 4.40E-09 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626188532 1.01E-06 1.36E-10 mr1534 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251