\
| Variant ID: vg0626134561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26134561 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 97. )
GTCTTCTTGATCCTAACCTAAAGTAAAGGGATTGGCAACGTACAAAAAAAATATCAAGGACCTAAAAGGAGGTACACAACGATTTTTTTTTAAAAAAGGC[G/A]
AAAATTAGAGAAAGAACTTATCTCTACTATTATAAAAATTGAATATCTTTTTGCCAGTACTTTAGCACTGTCAACGAGAAATCTCATAAACCGGATGAAT
ATTCATCCGGTTTATGAGATTTCTCGTTGACAGTGCTAAAGTACTGGCAAAAAGATATTCAATTTTTATAATAGTAGAGATAAGTTCTTTCTCTAATTTT[C/T]
GCCTTTTTTAAAAAAAAATCGTTGTGTACCTCCTTTTAGGTCCTTGATATTTTTTTTGTACGTTGCCAATCCCTTTACTTTAGGTTAGGATCAAGAAGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 14.90% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 57.50% | 41.30% | 1.26% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.80% | 23.30% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 25.80% | 74.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.50% | 29.90% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626134561 | G -> A | LOC_Os06g43480.1 | upstream_gene_variant ; 2468.0bp to feature; MODIFIER | silent_mutation | Average:31.909; most accessible tissue: Callus, score: 61.884 | N | N | N | N |
| vg0626134561 | G -> A | LOC_Os06g43470-LOC_Os06g43480 | intergenic_region ; MODIFIER | silent_mutation | Average:31.909; most accessible tissue: Callus, score: 61.884 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626134561 | 9.58E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0626134561 | NA | 1.11E-09 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0626134561 | NA | 1.91E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 3.36E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 5.03E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 1.16E-13 | mr1449 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 1.05E-06 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 3.20E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 3.20E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 5.68E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 1.32E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 6.22E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 3.20E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 5.50E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626134561 | NA | 9.44E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |