\
| Variant ID: vg0625703169 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25703169 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 120. )
AATTATATTAGTTATTAACAACAAATAAAATTAGTTTGACAGACTATGTTCTGAGATAAATACATTTAATAGACTATGTATGAGATTGTAGATGAAATAT[A/G]
CATGATATCCCGCACTTTGATTATATGCATGAATATATGTTAAGGATTATAAAAATATTGGATATATACATGTTAAAAATACTGTGAAAAATAATGTGAA
TTCACATTATTTTTCACAGTATTTTTAACATGTATATATCCAATATTTTTATAATCCTTAACATATATTCATGCATATAATCAAAGTGCGGGATATCATG[T/C]
ATATTTCATCTACAATCTCATACATAGTCTATTAAATGTATTTATCTCAGAACATAGTCTGTCAAACTAATTTTATTTGTTGTTAATAACTAATATAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625703169 | A -> G | LOC_Os06g42740.1 | upstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:60.547; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0625703169 | A -> G | LOC_Os06g42730.1 | downstream_gene_variant ; 368.0bp to feature; MODIFIER | silent_mutation | Average:60.547; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0625703169 | A -> G | LOC_Os06g42730-LOC_Os06g42740 | intergenic_region ; MODIFIER | silent_mutation | Average:60.547; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625703169 | NA | 7.40E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 9.69E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 1.39E-43 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 8.54E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 1.52E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 1.62E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | 9.01E-07 | NA | mr1415 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | 9.01E-07 | NA | mr1567 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 1.32E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 4.60E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 1.18E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 6.48E-30 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 2.38E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625703169 | NA | 4.79E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |