\
| Variant ID: vg0625701379 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25701379 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 291. )
AAGAGTGATGTATCCTGTAAAGCATACATACTGGTTTGACATATACAAGGTGATAACATTTCTTTGTTTATGTCAATCTTAACTTTGCTAGATCTAATAT[G/A]
CACTTTTTTATTTGCAGAATATTGATAAAGTTCCATTGGTCAAATGTCCTGTTTTAGTAATCCATGTGAGTATTCTTCTCATATCATTTTTAGCATGAAG
CTTCATGCTAAAAATGATATGAGAAGAATACTCACATGGATTACTAAAACAGGACATTTGACCAATGGAACTTTATCAATATTCTGCAAATAAAAAAGTG[C/T]
ATATTAGATCTAGCAAAGTTAAGATTGACATAAACAAAGAAATGTTATCACCTTGTATATGTCAAACCAGTATGTATGCTTTACAGGATACATCACTCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.00% | 85.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625701379 | G -> A | LOC_Os06g42740.1 | upstream_gene_variant ; 2662.0bp to feature; MODIFIER | silent_mutation | Average:52.506; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| vg0625701379 | G -> A | LOC_Os06g42730.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.506; most accessible tissue: Minghui63 flower, score: 64.266 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625701379 | NA | 1.18E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 1.69E-43 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 6.29E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 1.89E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 1.93E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | 4.98E-07 | NA | mr1415 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | 4.98E-07 | NA | mr1567 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 2.92E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 2.92E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 1.56E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 4.05E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 4.91E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625701379 | NA | 7.05E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |