\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625385908:

Variant ID: vg0625385908 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25385908
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGAAGGATGGGAAGAATTTCTTCCCGACTCTTGCACTTCGAGTTCCTCCTCCTCTGTTCCTGAGCTGCAGAATCCTTCCCCGGTTCTATTCACCTGCG[C/T]
GCACAGGTGTACCGGATGAGCAGGTGCCTCCGTAACTCCGTCCGCTTGAGAACTTGCACGGGTAGGCGGGCGATCAAGTTTTTGGGTAGCGCTTCAAGCG

Reverse complement sequence

CGCTTGAAGCGCTACCCAAAAACTTGATCGCCCGCCTACCCGTGCAAGTTCTCAAGCGGACGGAGTTACGGAGGCACCTGCTCATCCGGTACACCTGTGC[G/A]
CGCAGGTGAATAGAACCGGGGAAGGATTCTGCAGCTCAGGAACAGAGGAGGAGGAACTCGAAGTGCAAGAGTCGGGAAGAAATTCTTCCCATCCTTCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 2.40% 3.72% 8.63% NA
All Indica  2759 81.30% 0.20% 4.20% 14.32% NA
All Japonica  1512 89.20% 7.00% 3.44% 0.33% NA
Aus  269 97.40% 0.00% 1.12% 1.49% NA
Indica I  595 78.80% 0.50% 10.92% 9.75% NA
Indica II  465 88.40% 0.00% 2.80% 8.82% NA
Indica III  913 74.90% 0.10% 1.31% 23.66% NA
Indica Intermediate  786 86.30% 0.30% 3.31% 10.18% NA
Temperate Japonica  767 96.50% 0.00% 3.52% 0.00% NA
Tropical Japonica  504 75.40% 20.80% 2.98% 0.79% NA
Japonica Intermediate  241 95.00% 0.40% 4.15% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 91.10% 1.10% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625385908 C -> T LOC_Os06g42280.1 upstream_gene_variant ; 4124.0bp to feature; MODIFIER silent_mutation Average:42.429; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0625385908 C -> T LOC_Os06g42260.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:42.429; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0625385908 C -> T LOC_Os06g42270.1 downstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:42.429; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0625385908 C -> T LOC_Os06g42260-LOC_Os06g42270 intergenic_region ; MODIFIER silent_mutation Average:42.429; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0625385908 C -> DEL N N silent_mutation Average:42.429; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625385908 NA 6.82E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 1.07E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 2.80E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 2.11E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 2.99E-06 3.00E-06 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 1.69E-06 1.69E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 7.47E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 7.59E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 2.40E-06 2.39E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 7.81E-09 7.81E-09 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 2.68E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 4.90E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 2.59E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 1.67E-06 1.67E-06 mr1264_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625385908 NA 1.13E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251