\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625211382:

Variant ID: vg0625211382 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25211382
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTAGGCATTTTTTTCAATGTATATGACATGAATATTTTTAAGATTTGTTCTCACCTCTAGTGTTACTGATAACAATTGGTCGAGTGGTCACAATGTCC[A/G]
TCTGACCACTTATAGGTTTTCATGATAAGGGAGAGAGAGGATCGTGGAAACATCGACTAGAGGATATGATTTTTTTTTGCTTAAGTTAATGCGATGGGGG

Reverse complement sequence

CCCCCATCGCATTAACTTAAGCAAAAAAAAATCATATCCTCTAGTCGATGTTTCCACGATCCTCTCTCTCCCTTATCATGAAAACCTATAAGTGGTCAGA[T/C]
GGACATTGTGACCACTCGACCAATTGTTATCAGTAACACTAGAGGTGAGAACAAATCTTAAAAATATTCATGTCATATACATTGAAAAAAATGCCTAAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.40% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 69.20% 30.80% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 87.20% 12.80% 0.00% 0.00% NA
Tropical Japonica  504 53.60% 46.40% 0.00% 0.00% NA
Japonica Intermediate  241 44.40% 55.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625211382 A -> G LOC_Os06g41990.1 upstream_gene_variant ; 848.0bp to feature; MODIFIER silent_mutation Average:71.375; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0625211382 A -> G LOC_Os06g42000.1 upstream_gene_variant ; 2669.0bp to feature; MODIFIER silent_mutation Average:71.375; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0625211382 A -> G LOC_Os06g41990.2 upstream_gene_variant ; 848.0bp to feature; MODIFIER silent_mutation Average:71.375; most accessible tissue: Minghui63 flower, score: 79.679 N N N N
vg0625211382 A -> G LOC_Os06g41990-LOC_Os06g42000 intergenic_region ; MODIFIER silent_mutation Average:71.375; most accessible tissue: Minghui63 flower, score: 79.679 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625211382 4.68E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 3.56E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 3.36E-06 NA mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 2.76E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 9.86E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 3.89E-09 NA mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 NA 7.93E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 1.32E-10 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 3.31E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 1.18E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 7.62E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 3.53E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 NA 3.26E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 5.42E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625211382 NA 6.20E-08 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251