\
| Variant ID: vg0625171406 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25171406 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTCTCAAAAAGTTTAGCTAAGTTGACTTTAACCCCTAAACGAGTGATCTGCAAGTTTAGGAACCGGAATGACACAGTCGAACAAGTTTGAGGACCTGAA[C/T]
GGTCGATTTGCGAGTTTAGGGATCGGGATGACACAGCGGTACAAATTTATAGACCGGTGATGGACTTTACTCTTTTTTTTTCACCATGTTTGCAAGATAC
GTATCTTGCAAACATGGTGAAAAAAAAAGAGTAAAGTCCATCACCGGTCTATAAATTTGTACCGCTGTGTCATCCCGATCCCTAAACTCGCAAATCGACC[G/A]
TTCAGGTCCTCAAACTTGTTCGACTGTGTCATTCCGGTTCCTAAACTTGCAGATCACTCGTTTAGGGGTTAAAGTCAACTTAGCTAAACTTTTTGAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.90% | 0.60% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.70% | 1.90% | 1.46% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 2.90% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625171406 | C -> T | LOC_Os06g41940.1 | upstream_gene_variant ; 635.0bp to feature; MODIFIER | silent_mutation | Average:61.416; most accessible tissue: Minghui63 root, score: 91.589 | N | N | N | N |
| vg0625171406 | C -> T | LOC_Os06g41950.1 | downstream_gene_variant ; 2089.0bp to feature; MODIFIER | silent_mutation | Average:61.416; most accessible tissue: Minghui63 root, score: 91.589 | N | N | N | N |
| vg0625171406 | C -> T | LOC_Os06g41930-LOC_Os06g41940 | intergenic_region ; MODIFIER | silent_mutation | Average:61.416; most accessible tissue: Minghui63 root, score: 91.589 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625171406 | NA | 5.88E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625171406 | 2.77E-06 | NA | mr1089 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625171406 | 6.00E-06 | 6.00E-06 | mr1542 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625171406 | NA | 1.42E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625171406 | NA | 5.41E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625171406 | NA | 4.32E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |