\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625109737:

Variant ID: vg0625109737 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25109737
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATATCTACTCCCTCTGTCCCATAATATAGTAATATAGGACCGGACGAGACATTTCATAGTAAATGAATCTGGACACATTCGTTGTACTATGATCTC[G/A]
TCTAGTCCTAGATTATTATATTATAGGACGGAGGAAGTATATGCTAACTTGAGAAACGTGCTCACGATAATCAATAATCAATAAGCCAACAAGAATGTAC

Reverse complement sequence

GTACATTCTTGTTGGCTTATTGATTATTGATTATCGTGAGCACGTTTCTCAAGTTAGCATATACTTCCTCCGTCCTATAATATAATAATCTAGGACTAGA[C/T]
GAGATCATAGTACAACGAATGTGTCCAGATTCATTTACTATGAAATGTCTCGTCCGGTCCTATATTACTATATTATGGGACAGAGGGAGTAGATATTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 21.40% 8.70% 12.89% NA
All Indica  2759 61.90% 2.60% 14.03% 21.53% NA
All Japonica  1512 51.20% 48.30% 0.33% 0.13% NA
Aus  269 21.60% 73.60% 3.72% 1.12% NA
Indica I  595 82.00% 0.00% 11.93% 6.05% NA
Indica II  465 54.40% 1.50% 19.78% 24.30% NA
Indica III  913 55.20% 2.70% 11.17% 30.89% NA
Indica Intermediate  786 58.80% 5.00% 15.52% 20.74% NA
Temperate Japonica  767 19.80% 79.30% 0.65% 0.26% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 1.04% 1.04% NA
Intermediate  90 70.00% 11.10% 8.89% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625109737 G -> A LOC_Os06g41870.1 upstream_gene_variant ; 870.0bp to feature; MODIFIER silent_mutation Average:37.55; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0625109737 G -> A LOC_Os06g41870-LOC_Os06g41880 intergenic_region ; MODIFIER silent_mutation Average:37.55; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0625109737 G -> DEL N N silent_mutation Average:37.55; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625109737 NA 5.43E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 2.00E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 1.82E-11 mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 2.00E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 6.68E-12 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 3.57E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 8.53E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 2.59E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 5.80E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 2.95E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 7.82E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 6.15E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625109737 NA 2.37E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251