\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625085974:

Variant ID: vg0625085974 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25085974
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, G: 0.49, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AATGCGGCCGTCCGTTAGGCCTCCGGTTTCACTTCAAAACCGGCAACCTGTACATCGCCGACGCCTACATGGGATTGATGCGAGTTGGGCCAGGAGGAGG[G/T]
GAGGCAACCGTCTTAGCCACGAAAGCTGATGGCGTGCCACTTCGCTTCACCAATGGGGTGGACATTGATCAGGTTACCGGAGATGTTTATTTCACCGATA

Reverse complement sequence

TATCGGTGAAATAAACATCTCCGGTAACCTGATCAATGTCCACCCCATTGGTGAAGCGAAGTGGCACGCCATCAGCTTTCGTGGCTAAGACGGTTGCCTC[C/A]
CCTCCTCCTGGCCCAACTCGCATCAATCCCATGTAGGCGTCGGCGATGTACAGGTTGCCGGTTTTGAAGTGAAACCGGAGGCCTAACGGACGGCCGCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 35.80% 6.39% 1.95% NA
All Indica  2759 83.20% 3.50% 10.15% 3.15% NA
All Japonica  1512 4.40% 95.60% 0.00% 0.00% NA
Aus  269 83.30% 10.00% 5.58% 1.12% NA
Indica I  595 53.60% 0.20% 37.65% 8.57% NA
Indica II  465 92.50% 5.60% 1.08% 0.86% NA
Indica III  913 96.30% 1.20% 0.99% 1.53% NA
Indica Intermediate  786 85.00% 7.40% 5.34% 2.29% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 11.30% 88.70% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 43.30% 47.80% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625085974 G -> T LOC_Os06g41830.1 synonymous_variant ; p.Gly146Gly; LOW synonymous_codon Average:78.224; most accessible tissue: Minghui63 flag leaf, score: 88.103 N N N N
vg0625085974 G -> T LOC_Os06g41830.1 synonymous_variant ; p.Gly146Gly; LOW nonsynonymous_codon ; G146D Average:78.224; most accessible tissue: Minghui63 flag leaf, score: 88.103 benign 0.909 DELETERIOUS 0.01
vg0625085974 G -> DEL LOC_Os06g41830.1 N frameshift_variant Average:78.224; most accessible tissue: Minghui63 flag leaf, score: 88.103 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0625085974 G T 0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0625085974 9.99E-07 7.73E-07 mr1028 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 1.24E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 3.43E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 5.28E-44 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 7.37E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 1.66E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 2.13E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 8.44E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 4.84E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 1.93E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 7.44E-06 2.56E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 2.47E-06 4.87E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 1.54E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 9.43E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 3.29E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 4.47E-60 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 3.60E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 5.44E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 6.02E-39 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 2.03E-60 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 5.23E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 4.77E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 2.59E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0625085974 NA 1.47E-48 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251