| Variant ID: vg0625068800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 25068800 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 90. )
AAACTAATTACACAGTGTGCGTGTAAATTGCGAGATGAATCTTTTAAGCCTAATTGCACCATGATTTAACAATGTGGTGCTACAGTAAACATTTACTAAT[A/G]
ACGAATTAATTAGGCTTAATAAATTTGTCTCGCAGTTTCCTAGCGAAATCTGTAATTTGTTTTGTTATTAGACTACGTTTAGTATTTCAAATGTGTGTCC
GGACACACATTTGAAATACTAAACGTAGTCTAATAACAAAACAAATTACAGATTTCGCTAGGAAACTGCGAGACAAATTTATTAAGCCTAATTAATTCGT[T/C]
ATTAGTAAATGTTTACTGTAGCACCACATTGTTAAATCATGGTGCAATTAGGCTTAAAAGATTCATCTCGCAATTTACACGCACACTGTGTAATTAGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 26.10% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 32.30% | 67.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 90.70% | 8.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 50.10% | 49.40% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.80% | 81.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 79.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 34.40% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0625068800 | A -> G | LOC_Os06g41810.1 | downstream_gene_variant ; 4742.0bp to feature; MODIFIER | silent_mutation | Average:27.877; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0625068800 | A -> G | LOC_Os06g41800.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.877; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0625068800 | NA | 5.42E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 1.33E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 3.62E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 2.75E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 9.51E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | 1.13E-06 | 6.56E-10 | mr1805 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 5.08E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 8.75E-08 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0625068800 | NA | 1.10E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |