Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624684756:

Variant ID: vg0624684756 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 24684756
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATATGGTCGTCGTCGGACTGTGCTATACATTCAAAGGAAATATATTACTCCCTCTGTTTCATGTTACAAGACGTTTTATCTTTGGTTAAAGTCAAACT[G/A]
TTTCAAATTTGACTATGTTTATAGATTATAAATATAATAATATTTATAATACTAAATTACTTTCATCAAATTAATAATTGAATATATTTTCATAATAATT

Reverse complement sequence

AATTATTATGAAAATATATTCAATTATTAATTTGATGAAAGTAATTTAGTATTATAAATATTATTATATTTATAATCTATAAACATAGTCAAATTTGAAA[C/T]
AGTTTGACTTTAACCAAAGATAAAACGTCTTGTAACATGAAACAGAGGGAGTAATATATTTCCTTTGAATGTATAGCACAGTCCGACGACGACCATATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	8.20%	0.28%	4.02%	NA
All Indica	2759	98.20%	0.50%	0.04%	1.27%	NA
All Japonica	1512	65.20%	24.30%	0.73%	9.72%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.90%	1.90%	0.22%	1.94%	NA
Indica III	913	99.70%	0.20%	0.00%	0.11%	NA
Indica Intermediate	786	96.30%	0.50%	0.00%	3.18%	NA
Temperate Japonica	767	84.50%	14.50%	0.78%	0.26%	NA
Tropical Japonica	504	47.20%	25.60%	0.20%	26.98%	NA
Japonica Intermediate	241	41.50%	53.10%	1.66%	3.73%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	3.30%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0624684756	G -> A	LOC_Os06g41240.1	upstream_gene_variant ; 3527.0bp to feature; MODIFIER	silent_mutation	Average:62.339; most accessible tissue: Callus, score: 75.387	N	N	N	N
vg0624684756	G -> A	LOC_Os06g41250.1	intron_variant ; MODIFIER	silent_mutation	Average:62.339; most accessible tissue: Callus, score: 75.387	N	N	N	N
vg0624684756	G -> DEL	N	N	silent_mutation	Average:62.339; most accessible tissue: Callus, score: 75.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0624684756	NA	1.07E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	1.22E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	8.70E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	7.84E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	4.10E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	3.68E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	4.40E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	2.76E-07	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	5.05E-07	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	6.86E-10	mr1495_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	1.53E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	1.63E-08	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756	NA	1.21E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251