\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624684756:

Variant ID: vg0624684756 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24684756
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATATGGTCGTCGTCGGACTGTGCTATACATTCAAAGGAAATATATTACTCCCTCTGTTTCATGTTACAAGACGTTTTATCTTTGGTTAAAGTCAAACT[G/A]
TTTCAAATTTGACTATGTTTATAGATTATAAATATAATAATATTTATAATACTAAATTACTTTCATCAAATTAATAATTGAATATATTTTCATAATAATT

Reverse complement sequence

AATTATTATGAAAATATATTCAATTATTAATTTGATGAAAGTAATTTAGTATTATAAATATTATTATATTTATAATCTATAAACATAGTCAAATTTGAAA[C/T]
AGTTTGACTTTAACCAAAGATAAAACGTCTTGTAACATGAAACAGAGGGAGTAATATATTTCCTTTGAATGTATAGCACAGTCCGACGACGACCATATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 8.20% 0.28% 4.02% NA
All Indica  2759 98.20% 0.50% 0.04% 1.27% NA
All Japonica  1512 65.20% 24.30% 0.73% 9.72% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.90% 1.90% 0.22% 1.94% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 96.30% 0.50% 0.00% 3.18% NA
Temperate Japonica  767 84.50% 14.50% 0.78% 0.26% NA
Tropical Japonica  504 47.20% 25.60% 0.20% 26.98% NA
Japonica Intermediate  241 41.50% 53.10% 1.66% 3.73% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 3.30% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624684756 G -> A LOC_Os06g41240.1 upstream_gene_variant ; 3527.0bp to feature; MODIFIER silent_mutation Average:62.339; most accessible tissue: Callus, score: 75.387 N N N N
vg0624684756 G -> A LOC_Os06g41250.1 intron_variant ; MODIFIER silent_mutation Average:62.339; most accessible tissue: Callus, score: 75.387 N N N N
vg0624684756 G -> DEL N N silent_mutation Average:62.339; most accessible tissue: Callus, score: 75.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624684756 NA 1.07E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 1.22E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 8.70E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 7.84E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 4.10E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 3.68E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 4.40E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 2.76E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 5.05E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 6.86E-10 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 1.53E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 1.63E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624684756 NA 1.21E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251