\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624629721:

Variant ID: vg0624629721 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24629721
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATAAATATATTTTGTGGAGATAAAATAGGAGAGAGGAGCAGCGGGCTACAGATCTGTAGCTAGCCACATCACGGACTCAAAGATGCATGTATGTATGA[C/T]
AGGTGGGACCAGATATTAATTGTGTAGTATATGTTTATGTGTAACTATTATTGTATGAATTAATTAGCTATAAAATTGACTATAGATGATTTGGAGCCGA

Reverse complement sequence

TCGGCTCCAAATCATCTATAGTCAATTTTATAGCTAATTAATTCATACAATAATAGTTACACATAAACATATACTACACAATTAATATCTGGTCCCACCT[G/A]
TCATACATACATGCATCTTTGAGTCCGTGATGTGGCTAGCTACAGATCTGTAGCCCGCTGCTCCTCTCTCCTATTTTATCTCCACAAAATATATTTATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.60% 0.06% 0.00% NA
All Indica  2759 95.10% 4.90% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 22.70% 77.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 89.90% 10.10% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 14.60% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624629721 C -> T LOC_Os06g41150.1 downstream_gene_variant ; 2985.0bp to feature; MODIFIER silent_mutation Average:26.15; most accessible tissue: Callus, score: 51.212 N N N N
vg0624629721 C -> T LOC_Os06g41160.1 downstream_gene_variant ; 1070.0bp to feature; MODIFIER silent_mutation Average:26.15; most accessible tissue: Callus, score: 51.212 N N N N
vg0624629721 C -> T LOC_Os06g41160-LOC_Os06g41170 intergenic_region ; MODIFIER silent_mutation Average:26.15; most accessible tissue: Callus, score: 51.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624629721 NA 1.97E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 1.42E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 2.53E-29 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 9.64E-15 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 5.80E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 3.26E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 7.42E-08 mr1367 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 3.36E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 1.36E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 2.56E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 2.42E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624629721 NA 1.35E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251