\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0624472081:

Variant ID: vg0624472081 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 24472081
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CTCAACAGAGTATTCCTGTCTCTTGTGTTTGAGTGCAGTACCGAAACTTCTCCAAGATGGAGGAAGTTTCGCAATAATGCACCCGGCCACAAATTTGTCG[G/A]
GTAAGACACACTTAAGAAGTTCGAGTTCCTTAGCCATGGTTTATATCTCATGAGCCTGTTCGACTACAGAACGGTTGTCAGCCATCTTGTAGTCATGAAA

Reverse complement sequence

TTTCATGACTACAAGATGGCTGACAACCGTTCTGTAGTCGAACAGGCTCATGAGATATAAACCATGGCTAAGGAACTCGAACTTCTTAAGTGTGTCTTAC[C/T]
CGACAAATTTGTGGCCGGGTGCATTATTGCGAAACTTCCTCCATCTTGGAGAAGTTTCGGTACTGCACTCAAACACAAGAGACAGGAATACTCTGTTGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 38.00% 5.76% 1.82% NA
All Indica  2759 91.20% 4.90% 3.33% 0.65% NA
All Japonica  1512 0.60% 98.30% 1.12% 0.00% NA
Aus  269 6.30% 12.60% 56.88% 24.16% NA
Indica I  595 97.00% 2.20% 0.84% 0.00% NA
Indica II  465 89.70% 5.20% 4.52% 0.65% NA
Indica III  913 92.80% 3.60% 2.52% 1.10% NA
Indica Intermediate  786 85.80% 8.10% 5.47% 0.64% NA
Temperate Japonica  767 0.90% 98.80% 0.26% 0.00% NA
Tropical Japonica  504 0.40% 97.80% 1.79% 0.00% NA
Japonica Intermediate  241 0.00% 97.50% 2.49% 0.00% NA
VI/Aromatic  96 0.00% 91.70% 5.21% 3.12% NA
Intermediate  90 36.70% 57.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0624472081 G -> A LOC_Os06g40980.1 missense_variant ; p.Pro13Leu; MODERATE nonsynonymous_codon ; P13L Average:10.673; most accessible tissue: Minghui63 young leaf, score: 19.077 benign 0.378 DELETERIOUS 0.02
vg0624472081 G -> DEL LOC_Os06g40980.1 N frameshift_variant Average:10.673; most accessible tissue: Minghui63 young leaf, score: 19.077 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0624472081 NA 1.30E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 5.43E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 4.15E-44 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 7.73E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.76E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.74E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.68E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.07E-34 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.39E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 7.58E-06 2.10E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.74E-08 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 3.11E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.77E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 5.64E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 5.64E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.52E-31 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 1.20E-06 4.77E-08 mr1426 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 1.03E-06 4.46E-07 mr1500 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.06E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.74E-43 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 6.13E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 7.21E-17 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 4.92E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 6.43E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.41E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.57E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.13E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 8.74E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.17E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 1.37E-24 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0624472081 NA 2.69E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251