Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0623955389:

Variant ID: vg0623955389 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23955389
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GACTTTTTTAAATATGTTTAACTGTTCATCTTATTAAAAAAAATTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATATTTATAT[G/A]
TATACATATAGTTTTACATATTTCACAAAAGTATTTAATAAAAAAAGACGAACGGTCAAACATGTGCTTAAAAAGTCAATGGTGTCAAAGTATTTAGAAA

Reverse complement sequence

TTTCTAAATACTTTGACACCATTGACTTTTTAAGCACATGTTTGACCGTTCGTCTTTTTTTATTAAATACTTTTGTGAAATATGTAAAACTATATGTATA[C/T]
ATATAAATATATTTAACAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAATTTTTTTTAATAAGATGAACAGTTAAACATATTTAAAAAAGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	17.10%	0.89%	0.00%	NA
All Indica	2759	84.90%	14.60%	0.43%	0.00%	NA
All Japonica	1512	76.80%	21.40%	1.79%	0.00%	NA
Aus	269	82.50%	16.70%	0.74%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	84.90%	14.80%	0.22%	0.00%	NA
Indica III	913	78.60%	20.70%	0.66%	0.00%	NA
Indica Intermediate	786	81.20%	18.20%	0.64%	0.00%	NA
Temperate Japonica	767	96.20%	2.10%	1.69%	0.00%	NA
Tropical Japonica	504	45.40%	52.80%	1.79%	0.00%	NA
Japonica Intermediate	241	80.50%	17.40%	2.07%	0.00%	NA
VI/Aromatic	96	85.40%	13.50%	1.04%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623955389	G -> A	LOC_Os06g40210.1	downstream_gene_variant ; 4695.0bp to feature; MODIFIER	silent_mutation	Average:69.243; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0623955389	G -> A	LOC_Os06g40220.1	downstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:69.243; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0623955389	G -> A	LOC_Os06g40210-LOC_Os06g40220	intergenic_region ; MODIFIER	silent_mutation	Average:69.243; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623955389	NA	3.43E-06	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	4.43E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	1.90E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	9.06E-10	mr1072_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	3.67E-09	mr1075_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	1.91E-10	mr1077_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	1.26E-07	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	3.86E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	3.74E-08	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	3.23E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	1.15E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623955389	NA	3.87E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251