Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623601527:

Variant ID: vg0623601527 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23601527
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, C: 0.26, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATGTGGATTTTTCTCACGAGAGGTGGCAGTGGCGTATTTAGAATTTTTAAATGGATAGTCCAACCTATATATTTTTTTAAAATACCCTAAACATAAC[C/A]
AGGTTAGTTGTATAAATTGATCAAATGTGTATCATAATATATTCATAAGGGTTTTTTCTCAAAAGTTTATTTTCATATATGTACATATATGCATTAGGCT

Reverse complement sequence

AGCCTAATGCATATATGTACATATATGAAAATAAACTTTTGAGAAAAAACCCTTATGAATATATTATGATACACATTTGATCAATTTATACAACTAACCT[G/T]
GTTATGTTTAGGGTATTTTAAAAAAATATATAGGTTGGACTATCCATTTAAAAATTCTAAATACGCCACTGCCACCTCTCGTGAGAAAAATCCACATTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	32.50%	0.08%	0.00%	NA
All Indica	2759	67.00%	33.00%	0.00%	0.00%	NA
All Japonica	1512	78.60%	21.20%	0.13%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	91.40%	8.60%	0.00%	0.00%	NA
Indica II	465	84.30%	15.70%	0.00%	0.00%	NA
Indica III	913	42.60%	57.40%	0.00%	0.00%	NA
Indica Intermediate	786	66.50%	33.50%	0.00%	0.00%	NA
Temperate Japonica	767	61.90%	38.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.20%	0.20%	0.00%	NA
Japonica Intermediate	241	90.00%	9.50%	0.41%	0.00%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623601527	C -> A	LOC_Os06g39756-LOC_Os06g39750	intergenic_region ; MODIFIER	silent_mutation	Average:55.149; most accessible tissue: Zhenshan97 flower, score: 84.692	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623601527	NA	4.10E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	2.68E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	3.74E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	6.49E-06	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	1.96E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	3.20E-10	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	4.20E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	2.75E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	2.38E-12	mr1510_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	1.12E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	1.65E-19	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	8.80E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	5.15E-07	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623601527	NA	9.73E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251