Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0623453825:

Variant ID: vg0623453825 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 23453825
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCACTTGCTTTCCTCCCATCCCACCACACGCACGTCGCGCGGCCGGCACACGTACGTCTCTCCGTCTCTCAAACACGCCTACGTACACCGCCACAACC[C/T]
GTGCGTGCGCACGCGCGTGGCATGCATGGGTCCCCGGCCAACTCCCGTCGCTCGACGCGGCCCGATCGAATCGAATCAAAACCCGCACGCACACGAATTC

Reverse complement sequence

GAATTCGTGTGCGTGCGGGTTTTGATTCGATTCGATCGGGCCGCGTCGAGCGACGGGAGTTGGCCGGGGACCCATGCATGCCACGCGCGTGCGCACGCAC[G/A]
GGTTGTGGCGGTGTACGTAGGCGTGTTTGAGAGACGGAGAGACGTACGTGTGCCGGCCGCGCGACGTGCGTGTGGTGGGATGGGAGGAAAGCAAGTGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	9.00%	11.19%	22.75%	NA
All Indica	2759	37.80%	8.40%	17.65%	36.10%	NA
All Japonica	1512	98.70%	0.30%	0.40%	0.60%	NA
Aus	269	3.70%	66.20%	11.52%	18.59%	NA
Indica I	595	11.60%	2.20%	26.22%	60.00%	NA
Indica II	465	56.60%	9.90%	7.31%	26.24%	NA
Indica III	913	40.60%	10.30%	19.28%	29.79%	NA
Indica Intermediate	786	43.40%	10.10%	15.39%	31.17%	NA
Temperate Japonica	767	98.60%	0.40%	0.26%	0.78%	NA
Tropical Japonica	504	99.00%	0.40%	0.60%	0.00%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	91.70%	4.20%	1.04%	3.12%	NA
Intermediate	90	72.20%	4.40%	4.44%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623453825	C -> T	LOC_Os06g39480.1	upstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:90.922; most accessible tissue: Zhenshan97 flower, score: 97.811	N	N	N	N
vg0623453825	C -> T	LOC_Os06g39500.1	upstream_gene_variant ; 1645.0bp to feature; MODIFIER	silent_mutation	Average:90.922; most accessible tissue: Zhenshan97 flower, score: 97.811	N	N	N	N
vg0623453825	C -> T	LOC_Os06g39510.1	upstream_gene_variant ; 2761.0bp to feature; MODIFIER	silent_mutation	Average:90.922; most accessible tissue: Zhenshan97 flower, score: 97.811	N	N	N	N
vg0623453825	C -> T	LOC_Os06g39500-LOC_Os06g39510	intergenic_region ; MODIFIER	silent_mutation	Average:90.922; most accessible tissue: Zhenshan97 flower, score: 97.811	N	N	N	N
vg0623453825	C -> DEL	N	N	silent_mutation	Average:90.922; most accessible tissue: Zhenshan97 flower, score: 97.811	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0623453825	C	T	-0.08	-0.07	-0.05	0.01	-0.01	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623453825	NA	1.32E-11	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	2.60E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	8.26E-09	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.59E-11	mr1052	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.68E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.52E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.05E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.30E-06	mr1847	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	9.46E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.16E-07	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623453825	NA	1.90E-06	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251