\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623192972:

Variant ID: vg0623192972 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23192972
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.04, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AACGCTCTTAAGCTGCCAAGTAGGACTCCTACAAATGCTCTTAGTCCGTCACGTGACTCCATCAAATCTAACCGTTGATTTTCACTTAAATGGTGAACCC[G/T]
ATAATTTTAAACCATTAGATTAAACTTTCCGGTGGACCCGATATTTTAGGCCATTAGATTACATATATTTTAAAAAAAGAAACTAATTCCTTAGGCAGTT

Reverse complement sequence

AACTGCCTAAGGAATTAGTTTCTTTTTTTAAAATATATGTAATCTAATGGCCTAAAATATCGGGTCCACCGGAAAGTTTAATCTAATGGTTTAAAATTAT[C/A]
GGGTTCACCATTTAAGTGAAAATCAACGGTTAGATTTGATGGAGTCACGTGACGGACTAAGAGCATTTGTAGGAGTCCTACTTGGCAGCTTAAGAGCGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 30.30% 0.42% 5.42% NA
All Indica  2759 95.90% 3.00% 0.54% 0.58% NA
All Japonica  1512 3.80% 80.60% 0.07% 15.48% NA
Aus  269 96.70% 1.50% 0.37% 1.49% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 93.10% 6.50% 0.43% 0.00% NA
Indica III  913 96.60% 0.50% 1.31% 1.53% NA
Indica Intermediate  786 94.00% 5.60% 0.13% 0.25% NA
Temperate Japonica  767 2.00% 72.00% 0.13% 25.95% NA
Tropical Japonica  504 7.10% 92.30% 0.00% 0.60% NA
Japonica Intermediate  241 2.90% 83.80% 0.00% 13.28% NA
VI/Aromatic  96 8.30% 89.60% 0.00% 2.08% NA
Intermediate  90 52.20% 44.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623192972 G -> T LOC_Os06g39060.1 upstream_gene_variant ; 3905.0bp to feature; MODIFIER silent_mutation Average:32.517; most accessible tissue: Callus, score: 55.951 N N N N
vg0623192972 G -> T LOC_Os06g39070.1 upstream_gene_variant ; 3384.0bp to feature; MODIFIER silent_mutation Average:32.517; most accessible tissue: Callus, score: 55.951 N N N N
vg0623192972 G -> T LOC_Os06g39060-LOC_Os06g39070 intergenic_region ; MODIFIER silent_mutation Average:32.517; most accessible tissue: Callus, score: 55.951 N N N N
vg0623192972 G -> DEL N N silent_mutation Average:32.517; most accessible tissue: Callus, score: 55.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623192972 NA 1.44E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 7.60E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 2.72E-10 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 1.15E-09 4.80E-12 mr1083 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 4.29E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 9.47E-09 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 9.03E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 1.20E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 9.23E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 6.24E-11 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 5.98E-10 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 7.00E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 3.59E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 5.81E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 2.81E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 1.62E-09 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192972 NA 1.41E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251