\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623192526:

Variant ID: vg0623192526 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23192526
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATATTTAATTGTAACAAATATAATGGTGTAAAGATAAATGGTTTAGGAGAAAAAAACATTTAGAGCTTGCTTCACAGAAAATCAAACCAACCACAGC[C/T]
AATCAGAATACGACATATCACCCAGACCAAAACTGGATGGCTTCATCGAGCATATTGAGGGAATATTCTATATTTCGGACCACCCCATCTACCCTGCCCT

Reverse complement sequence

AGGGCAGGGTAGATGGGGTGGTCCGAAATATAGAATATTCCCTCAATATGCTCGATGAAGCCATCCAGTTTTGGTCTGGGTGATATGTCGTATTCTGATT[G/A]
GCTGTGGTTGGTTTGATTTTCTGTGAAGCAAGCTCTAAATGTTTTTTTCTCCTAAACCATTTATCTTTACACCATTATATTTGTTACAATTAAATATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 27.30% 0.25% 0.00% NA
All Indica  2759 57.90% 41.80% 0.36% 0.00% NA
All Japonica  1512 97.60% 2.30% 0.07% 0.00% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 17.80% 82.00% 0.17% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 58.40% 41.10% 0.55% 0.00% NA
Indica Intermediate  786 66.80% 32.70% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623192526 C -> T LOC_Os06g39060.1 upstream_gene_variant ; 3459.0bp to feature; MODIFIER silent_mutation Average:46.728; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0623192526 C -> T LOC_Os06g39070.1 upstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:46.728; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0623192526 C -> T LOC_Os06g39060-LOC_Os06g39070 intergenic_region ; MODIFIER silent_mutation Average:46.728; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623192526 NA 1.50E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 9.13E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 4.27E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 3.28E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 2.50E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 2.24E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 3.74E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 7.40E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 2.87E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 8.01E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 1.40E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 4.91E-06 4.90E-06 mr1466 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 1.02E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 3.56E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 1.01E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 1.17E-07 NA mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 4.61E-08 4.59E-11 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 3.92E-09 mr1715 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 6.65E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 5.95E-07 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 4.53E-10 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623192526 NA 2.40E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251