\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623056011:

Variant ID: vg0623056011 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 23056011
Reference Allele: GAlternative Allele: A,GCGT,GT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAACATTTGATGATAAATCAAGTCACAATAAAATAAATGATAATTACATAAATTTGTTAAATTAAAACGAATGGTCAAAGTTAGATAAAAAATCAATG[G/A,GCGT,GT]
CATCATACATTAAAATACGGAGGTAGTACTTTTTTTTGGTAGCATTTGTTTGGTTTGGGGACCAAGTGGGATGGGTTAGATCTATTCTAATTTTTTGGGA

Reverse complement sequence

TCCCAAAAAATTAGAATAGATCTAACCCATCCCACTTGGTCCCCAAACCAAACAAATGCTACCAAAAAAAAGTACTACCTCCGTATTTTAATGTATGATG[C/T,ACGC,AC]
CATTGATTTTTTATCTAACTTTGACCATTCGTTTTAATTTAACAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTTATCATCAAATGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 18.60% 2.12% 13.29% GT: 7.07%; GCGT: 5.90%
All Indica  2759 38.90% 28.20% 2.61% 11.92% GT: 11.38%; GCGT: 6.92%
All Japonica  1512 85.80% 1.10% 0.99% 9.79% GCGT: 2.12%; GT: 0.20%
Aus  269 4.80% 26.80% 4.46% 52.79% GCGT: 8.18%; GT: 2.97%
Indica I  595 18.70% 66.90% 3.53% 9.92% GT: 1.01%
Indica II  465 69.50% 5.40% 1.08% 6.67% GT: 10.32%; GCGT: 7.10%
Indica III  913 32.40% 16.80% 3.07% 18.73% GT: 16.32%; GCGT: 12.71%
Indica Intermediate  786 43.80% 25.80% 2.29% 8.65% GT: 14.12%; GCGT: 5.34%
Temperate Japonica  767 81.60% 0.10% 0.65% 14.08% GCGT: 3.52%
Tropical Japonica  504 90.90% 2.40% 1.59% 3.97% GT: 0.60%; GCGT: 0.60%
Japonica Intermediate  241 88.80% 1.20% 0.83% 8.30% GCGT: 0.83%
VI/Aromatic  96 62.50% 1.00% 0.00% 2.08% GCGT: 29.17%; GT: 5.21%
Intermediate  90 70.00% 10.00% 1.11% 7.78% GCGT: 6.67%; GT: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623056011 G -> A LOC_Os06g38830.1 upstream_gene_variant ; 3695.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> A LOC_Os06g38850.1 upstream_gene_variant ; 1298.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> A LOC_Os06g38840.1 intron_variant ; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> DEL N N silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GCGT LOC_Os06g38830.1 upstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GCGT LOC_Os06g38850.1 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GCGT LOC_Os06g38840.1 intron_variant ; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GT LOC_Os06g38830.1 upstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GT LOC_Os06g38850.1 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N
vg0623056011 G -> GT LOC_Os06g38840.1 intron_variant ; MODIFIER silent_mutation Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623056011 NA 4.59E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 2.27E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 2.85E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 8.33E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 9.94E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 3.74E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.76E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 4.45E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 3.16E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.40E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 4.61E-07 5.10E-10 mr1659 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.59E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.96E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 8.12E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.80E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 2.93E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 9.05E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 8.95E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 6.31E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 3.47E-07 NA mr1659_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 1.49E-06 1.98E-11 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 4.25E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 2.28E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 1.17E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 3.92E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 2.65E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 3.11E-09 mr1915_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 NA 8.24E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011 2.60E-06 2.61E-06 mr1956_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251