Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623056011:

Variant ID: vg0623056011 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 23056011
Reference Allele: G	Alternative Allele: A,GCGT,GT
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAACATTTGATGATAAATCAAGTCACAATAAAATAAATGATAATTACATAAATTTGTTAAATTAAAACGAATGGTCAAAGTTAGATAAAAAATCAATG[G/A,GCGT,GT]
CATCATACATTAAAATACGGAGGTAGTACTTTTTTTTGGTAGCATTTGTTTGGTTTGGGGACCAAGTGGGATGGGTTAGATCTATTCTAATTTTTTGGGA

Reverse complement sequence

TCCCAAAAAATTAGAATAGATCTAACCCATCCCACTTGGTCCCCAAACCAAACAAATGCTACCAAAAAAAAGTACTACCTCCGTATTTTAATGTATGATG[C/T,ACGC,AC]
CATTGATTTTTTATCTAACTTTGACCATTCGTTTTAATTTAACAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTTATCATCAAATGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	18.60%	2.12%	13.29%	GT: 7.07%; GCGT: 5.90%
All Indica	2759	38.90%	28.20%	2.61%	11.92%	GT: 11.38%; GCGT: 6.92%
All Japonica	1512	85.80%	1.10%	0.99%	9.79%	GCGT: 2.12%; GT: 0.20%
Aus	269	4.80%	26.80%	4.46%	52.79%	GCGT: 8.18%; GT: 2.97%
Indica I	595	18.70%	66.90%	3.53%	9.92%	GT: 1.01%
Indica II	465	69.50%	5.40%	1.08%	6.67%	GT: 10.32%; GCGT: 7.10%
Indica III	913	32.40%	16.80%	3.07%	18.73%	GT: 16.32%; GCGT: 12.71%
Indica Intermediate	786	43.80%	25.80%	2.29%	8.65%	GT: 14.12%; GCGT: 5.34%
Temperate Japonica	767	81.60%	0.10%	0.65%	14.08%	GCGT: 3.52%
Tropical Japonica	504	90.90%	2.40%	1.59%	3.97%	GT: 0.60%; GCGT: 0.60%
Japonica Intermediate	241	88.80%	1.20%	0.83%	8.30%	GCGT: 0.83%
VI/Aromatic	96	62.50%	1.00%	0.00%	2.08%	GCGT: 29.17%; GT: 5.21%
Intermediate	90	70.00%	10.00%	1.11%	7.78%	GCGT: 6.67%; GT: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0623056011	G -> A	LOC_Os06g38830.1	upstream_gene_variant ; 3695.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> A	LOC_Os06g38850.1	upstream_gene_variant ; 1298.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> A	LOC_Os06g38840.1	intron_variant ; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> DEL	N	N	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GCGT	LOC_Os06g38830.1	upstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GCGT	LOC_Os06g38850.1	upstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GCGT	LOC_Os06g38840.1	intron_variant ; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GT	LOC_Os06g38830.1	upstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GT	LOC_Os06g38850.1	upstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N
vg0623056011	G -> GT	LOC_Os06g38840.1	intron_variant ; MODIFIER	silent_mutation	Average:41.428; most accessible tissue: Zhenshan97 young leaf, score: 59.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0623056011	NA	4.59E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	2.27E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	2.85E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	8.33E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	9.94E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	3.74E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.76E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	4.45E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	3.16E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.40E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	4.61E-07	5.10E-10	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.59E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.96E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	8.12E-06	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.80E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	2.93E-09	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	9.05E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	8.95E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	6.31E-07	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	3.47E-07	NA	mr1659_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	1.49E-06	1.98E-11	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	4.25E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	2.28E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	1.17E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	3.92E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	2.65E-14	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	3.11E-09	mr1915_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	NA	8.24E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623056011	2.60E-06	2.61E-06	mr1956_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251