\
| Variant ID: vg0623014401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 23014401 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 63. )
AATGGAGAGTCACGCATTAAATCCGAGAAAGCCATTAAGATAATAGGTTGTTTAATTGAAATATGCCTATCGAAAATAAATTTTTCAGATTTAGAAATAT[G/A]
ACTATCAAAAGTAGATGGAGGGAGTATATGAATATATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAG
CTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATATATTCATATACTCCCTCCATCTACTTTTGATAGT[C/T]
ATATTTCTAAATCTGAAAAATTTATTTTCGATAGGCATATTTCAATTAAACAACCTATTATCTTAATGGCTTTCTCGGATTTAATGCGTGACTCTCCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.80% | 25.80% | 0.76% | 33.64% | NA |
| All Indica | 2759 | 27.90% | 37.10% | 0.58% | 34.47% | NA |
| All Japonica | 1512 | 65.30% | 1.50% | 0.93% | 32.28% | NA |
| Aus | 269 | 8.60% | 53.90% | 1.49% | 36.06% | NA |
| Indica I | 595 | 3.90% | 16.50% | 1.18% | 78.49% | NA |
| Indica II | 465 | 25.80% | 68.80% | 0.65% | 4.73% | NA |
| Indica III | 913 | 44.50% | 28.70% | 0.22% | 26.62% | NA |
| Indica Intermediate | 786 | 28.00% | 43.60% | 0.51% | 27.86% | NA |
| Temperate Japonica | 767 | 52.20% | 2.10% | 1.56% | 44.20% | NA |
| Tropical Japonica | 504 | 83.70% | 0.60% | 0.40% | 15.28% | NA |
| Japonica Intermediate | 241 | 68.90% | 1.20% | 0.00% | 29.88% | NA |
| VI/Aromatic | 96 | 55.20% | 4.20% | 2.08% | 38.54% | NA |
| Intermediate | 90 | 53.30% | 27.80% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0623014401 | G -> A | LOC_Os06g38780.1 | upstream_gene_variant ; 3460.0bp to feature; MODIFIER | silent_mutation | Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg0623014401 | G -> A | LOC_Os06g38760.1 | downstream_gene_variant ; 2930.0bp to feature; MODIFIER | silent_mutation | Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg0623014401 | G -> A | LOC_Os06g38770.1 | downstream_gene_variant ; 1835.0bp to feature; MODIFIER | silent_mutation | Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg0623014401 | G -> A | LOC_Os06g38764.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| vg0623014401 | G -> DEL | N | N | silent_mutation | Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0623014401 | NA | 8.95E-07 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 1.04E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 3.56E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 1.41E-08 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 1.41E-08 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 8.51E-08 | mr1811 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | NA | 4.39E-06 | mr1812 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0623014401 | 1.92E-06 | 1.92E-06 | mr1427_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |