\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0623014401:

Variant ID: vg0623014401 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 23014401
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGAGAGTCACGCATTAAATCCGAGAAAGCCATTAAGATAATAGGTTGTTTAATTGAAATATGCCTATCGAAAATAAATTTTTCAGATTTAGAAATAT[G/A]
ACTATCAAAAGTAGATGGAGGGAGTATATGAATATATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAG

Reverse complement sequence

CTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATATATTCATATACTCCCTCCATCTACTTTTGATAGT[C/T]
ATATTTCTAAATCTGAAAAATTTATTTTCGATAGGCATATTTCAATTAAACAACCTATTATCTTAATGGCTTTCTCGGATTTAATGCGTGACTCTCCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 25.80% 0.76% 33.64% NA
All Indica  2759 27.90% 37.10% 0.58% 34.47% NA
All Japonica  1512 65.30% 1.50% 0.93% 32.28% NA
Aus  269 8.60% 53.90% 1.49% 36.06% NA
Indica I  595 3.90% 16.50% 1.18% 78.49% NA
Indica II  465 25.80% 68.80% 0.65% 4.73% NA
Indica III  913 44.50% 28.70% 0.22% 26.62% NA
Indica Intermediate  786 28.00% 43.60% 0.51% 27.86% NA
Temperate Japonica  767 52.20% 2.10% 1.56% 44.20% NA
Tropical Japonica  504 83.70% 0.60% 0.40% 15.28% NA
Japonica Intermediate  241 68.90% 1.20% 0.00% 29.88% NA
VI/Aromatic  96 55.20% 4.20% 2.08% 38.54% NA
Intermediate  90 53.30% 27.80% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0623014401 G -> A LOC_Os06g38780.1 upstream_gene_variant ; 3460.0bp to feature; MODIFIER silent_mutation Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0623014401 G -> A LOC_Os06g38760.1 downstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0623014401 G -> A LOC_Os06g38770.1 downstream_gene_variant ; 1835.0bp to feature; MODIFIER silent_mutation Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0623014401 G -> A LOC_Os06g38764.1 intron_variant ; MODIFIER silent_mutation Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 N N N N
vg0623014401 G -> DEL N N silent_mutation Average:34.905; most accessible tissue: Minghui63 root, score: 81.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0623014401 NA 8.95E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 1.04E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 3.56E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 1.41E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 1.41E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 8.51E-08 mr1811 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 NA 4.39E-06 mr1812 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0623014401 1.92E-06 1.92E-06 mr1427_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251