Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622815669:

Variant ID: vg0622815669 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22815669
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AGAACCCCTTACATTTAGTGTCGGAAAGAATACACCATTAATAAAAATGGGTTAATTGGATTCATGCCTCTATAAATATGACAAATAAGAAAAATGTCAC[C/T,A]
ATTATTCATGAAATCGGGTAGATGCTACTGTAAATTAGAATCATGCCACACTACTACAAAAGTGATTTTTCTATACGAGGCCTCATCATTTTTCCATGCG

Reverse complement sequence

CGCATGGAAAAATGATGAGGCCTCGTATAGAAAAATCACTTTTGTAGTAGTGTGGCATGATTCTAATTTACAGTAGCATCTACCCGATTTCATGAATAAT[G/A,T]
GTGACATTTTTCTTATTTGTCATATTTATAGAGGCATGAATCCAATTAACCCATTTTTATTAATGGTGTATTCTTTCCGACACTAAATGTAAGGGGTTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.10%	35.70%	0.23%	15.98%	A: 0.02%
All Indica	2759	70.10%	10.70%	0.22%	19.03%	NA
All Japonica	1512	6.70%	79.30%	0.20%	13.82%	NA
Aus	269	41.60%	55.80%	0.37%	1.86%	A: 0.37%
Indica I	595	85.20%	1.00%	0.00%	13.78%	NA
Indica II	465	75.50%	13.10%	0.00%	11.40%	NA
Indica III	913	59.70%	14.00%	0.22%	26.07%	NA
Indica Intermediate	786	67.60%	12.60%	0.51%	19.34%	NA
Temperate Japonica	767	1.60%	80.20%	0.26%	17.99%	NA
Tropical Japonica	504	14.90%	82.70%	0.00%	2.38%	NA
Japonica Intermediate	241	5.80%	69.30%	0.41%	24.48%	NA
VI/Aromatic	96	83.30%	14.60%	0.00%	2.08%	NA
Intermediate	90	52.20%	31.10%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622815669	C -> T	LOC_Os06g38500.1	upstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> T	LOC_Os06g38490.1	downstream_gene_variant ; 2400.0bp to feature; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> T	LOC_Os06g38490-LOC_Os06g38500	intergenic_region ; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> A	LOC_Os06g38500.1	upstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> A	LOC_Os06g38490.1	downstream_gene_variant ; 2400.0bp to feature; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> A	LOC_Os06g38490-LOC_Os06g38500	intergenic_region ; MODIFIER	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N
vg0622815669	C -> DEL	N	N	silent_mutation	Average:25.339; most accessible tissue: Callus, score: 47.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622815669	NA	2.14E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	7.91E-07	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	5.73E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	5.87E-06	5.95E-08	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	4.97E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	2.14E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	2.34E-14	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	1.62E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	1.88E-06	mr1528	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	7.43E-06	mr1574	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	8.68E-11	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	7.18E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	1.23E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	2.42E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	7.83E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	1.16E-12	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	5.05E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	8.53E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	1.08E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	9.58E-06	4.10E-08	mr1981	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669	NA	9.79E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251