\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622815669:

Variant ID: vg0622815669 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22815669
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGAACCCCTTACATTTAGTGTCGGAAAGAATACACCATTAATAAAAATGGGTTAATTGGATTCATGCCTCTATAAATATGACAAATAAGAAAAATGTCAC[C/T,A]
ATTATTCATGAAATCGGGTAGATGCTACTGTAAATTAGAATCATGCCACACTACTACAAAAGTGATTTTTCTATACGAGGCCTCATCATTTTTCCATGCG

Reverse complement sequence

CGCATGGAAAAATGATGAGGCCTCGTATAGAAAAATCACTTTTGTAGTAGTGTGGCATGATTCTAATTTACAGTAGCATCTACCCGATTTCATGAATAAT[G/A,T]
GTGACATTTTTCTTATTTGTCATATTTATAGAGGCATGAATCCAATTAACCCATTTTTATTAATGGTGTATTCTTTCCGACACTAAATGTAAGGGGTTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 35.70% 0.23% 15.98% A: 0.02%
All Indica  2759 70.10% 10.70% 0.22% 19.03% NA
All Japonica  1512 6.70% 79.30% 0.20% 13.82% NA
Aus  269 41.60% 55.80% 0.37% 1.86% A: 0.37%
Indica I  595 85.20% 1.00% 0.00% 13.78% NA
Indica II  465 75.50% 13.10% 0.00% 11.40% NA
Indica III  913 59.70% 14.00% 0.22% 26.07% NA
Indica Intermediate  786 67.60% 12.60% 0.51% 19.34% NA
Temperate Japonica  767 1.60% 80.20% 0.26% 17.99% NA
Tropical Japonica  504 14.90% 82.70% 0.00% 2.38% NA
Japonica Intermediate  241 5.80% 69.30% 0.41% 24.48% NA
VI/Aromatic  96 83.30% 14.60% 0.00% 2.08% NA
Intermediate  90 52.20% 31.10% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622815669 C -> T LOC_Os06g38500.1 upstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> T LOC_Os06g38490.1 downstream_gene_variant ; 2400.0bp to feature; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> T LOC_Os06g38490-LOC_Os06g38500 intergenic_region ; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> A LOC_Os06g38500.1 upstream_gene_variant ; 2162.0bp to feature; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> A LOC_Os06g38490.1 downstream_gene_variant ; 2400.0bp to feature; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> A LOC_Os06g38490-LOC_Os06g38500 intergenic_region ; MODIFIER silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N
vg0622815669 C -> DEL N N silent_mutation Average:25.339; most accessible tissue: Callus, score: 47.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622815669 NA 2.14E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 7.91E-07 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 5.73E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 5.87E-06 5.95E-08 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 4.97E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 2.14E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 2.34E-14 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 1.62E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 1.88E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 7.43E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 8.68E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 7.18E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 1.23E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 2.42E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 7.83E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 1.16E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 5.05E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 8.53E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 1.08E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 9.58E-06 4.10E-08 mr1981 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622815669 NA 9.79E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251