\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622804797:

Variant ID: vg0622804797 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22804797
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.39, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCGGGAAGCGTGGGCGTCGTCGTGGTCGCGCCATCGCCATCGACCTTAACAATCTCGGGCTGGCTGGTAGCATCTCCCCTTCCATTTCTAATCTTAC[G/A]
TACCTCAGGAAGCTCCACTTGCCACAGAACCAGTTTGGTGGGCACATCCCACATGAACTCGGCCTTCTCGACGATCTTAAGTTTCTGAACTTTGTGAATT

Reverse complement sequence

AATTCACAAAGTTCAGAAACTTAAGATCGTCGAGAAGGCCGAGTTCATGTGGGATGTGCCCACCAAACTGGTTCTGTGGCAAGTGGAGCTTCCTGAGGTA[C/T]
GTAAGATTAGAAATGGAAGGGGAGATGCTACCAGCCAGCCCGAGATTGTTAAGGTCGATGGCGATGGCGCGACCACGACGACGCCCACGCTTCCCGCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.60% 0.23% 0.00% NA
All Indica  2759 77.30% 22.30% 0.36% 0.00% NA
All Japonica  1512 17.00% 83.00% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 85.70% 14.30% 0.00% 0.00% NA
Indica II  465 83.90% 15.90% 0.22% 0.00% NA
Indica III  913 71.30% 28.10% 0.55% 0.00% NA
Indica Intermediate  786 74.20% 25.30% 0.51% 0.00% NA
Temperate Japonica  767 9.40% 90.60% 0.00% 0.00% NA
Tropical Japonica  504 29.60% 70.40% 0.00% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622804797 G -> A LOC_Os06g38470.1 upstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38490.1 upstream_gene_variant ; 4854.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38470.3 upstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38470.2 upstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38480.1 downstream_gene_variant ; 2727.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38480.2 downstream_gene_variant ; 2727.0bp to feature; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0622804797 G -> A LOC_Os06g38470-LOC_Os06g38480 intergenic_region ; MODIFIER silent_mutation Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622804797 NA 3.80E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 NA 4.71E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 NA 4.79E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 NA 1.92E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 NA 2.21E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 4.44E-06 NA mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797 NA 2.87E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251