\
| Variant ID: vg0622804797 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22804797 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.39, others allele: 0.00, population size: 94. )
TGTGCGGGAAGCGTGGGCGTCGTCGTGGTCGCGCCATCGCCATCGACCTTAACAATCTCGGGCTGGCTGGTAGCATCTCCCCTTCCATTTCTAATCTTAC[G/A]
TACCTCAGGAAGCTCCACTTGCCACAGAACCAGTTTGGTGGGCACATCCCACATGAACTCGGCCTTCTCGACGATCTTAAGTTTCTGAACTTTGTGAATT
AATTCACAAAGTTCAGAAACTTAAGATCGTCGAGAAGGCCGAGTTCATGTGGGATGTGCCCACCAAACTGGTTCTGTGGCAAGTGGAGCTTCCTGAGGTA[C/T]
GTAAGATTAGAAATGGAAGGGGAGATGCTACCAGCCAGCCCGAGATTGTTAAGGTCGATGGCGATGGCGCGACCACGACGACGCCCACGCTTCCCGCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.60% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 77.30% | 22.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 17.00% | 83.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.90% | 15.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.30% | 28.10% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 74.20% | 25.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622804797 | G -> A | LOC_Os06g38470.1 | upstream_gene_variant ; 4576.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38490.1 | upstream_gene_variant ; 4854.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38470.3 | upstream_gene_variant ; 4601.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38470.2 | upstream_gene_variant ; 4576.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38480.1 | downstream_gene_variant ; 2727.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38480.2 | downstream_gene_variant ; 2727.0bp to feature; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0622804797 | G -> A | LOC_Os06g38470-LOC_Os06g38480 | intergenic_region ; MODIFIER | silent_mutation | Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622804797 | NA | 3.80E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | NA | 4.71E-07 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | NA | 4.79E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | NA | 1.92E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | NA | 2.21E-06 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | 4.44E-06 | NA | mr1846 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622804797 | NA | 2.87E-07 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |