\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622667500:

Variant ID: vg0622667500 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22667500
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGAAGAATCCATATAAGAATCCAATACGAGATTAATTAAAATTTAGAATAAAAATATAATAATATCCAAAATTAGAAAAACTAAAACAGAGTTCAA[G/T]
TAGGAATACAATTTTGAAACAACTGAAATTCAGAATAAAAAATAAAAACATTAAAAGAACACAATATGGTATTAACTAATTTTTTTAGAAAAAAATAAAT

Reverse complement sequence

ATTTATTTTTTTCTAAAAAAATTAGTTAATACCATATTGTGTTCTTTTAATGTTTTTATTTTTTATTCTGAATTTCAGTTGTTTCAAAATTGTATTCCTA[C/A]
TTGAACTCTGTTTTAGTTTTTCTAATTTTGGATATTATTATATTTTTATTCTAAATTTTAATTAATCTCGTATTGGATTCTTATATGGATTCTTCTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 9.30% 0.11% 0.04% NA
All Indica  2759 99.40% 0.50% 0.07% 0.04% NA
All Japonica  1512 72.00% 27.90% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.60% 0.22% 0.22% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 83.20% 16.80% 0.00% 0.00% NA
Tropical Japonica  504 61.70% 37.90% 0.40% 0.00% NA
Japonica Intermediate  241 57.70% 42.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622667500 G -> T LOC_Os06g38294.1 upstream_gene_variant ; 2411.0bp to feature; MODIFIER silent_mutation Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 N N N N
vg0622667500 G -> T LOC_Os06g38294-LOC_Os06g38310 intergenic_region ; MODIFIER silent_mutation Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 N N N N
vg0622667500 G -> DEL N N silent_mutation Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622667500 NA 1.01E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 NA 5.87E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 NA 9.33E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 NA 6.26E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 NA 1.34E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 NA 3.36E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 9.50E-06 3.70E-08 mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622667500 5.05E-08 2.04E-22 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251