| Variant ID: vg0622667500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22667500 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAAAGAAGAATCCATATAAGAATCCAATACGAGATTAATTAAAATTTAGAATAAAAATATAATAATATCCAAAATTAGAAAAACTAAAACAGAGTTCAA[G/T]
TAGGAATACAATTTTGAAACAACTGAAATTCAGAATAAAAAATAAAAACATTAAAAGAACACAATATGGTATTAACTAATTTTTTTAGAAAAAAATAAAT
ATTTATTTTTTTCTAAAAAAATTAGTTAATACCATATTGTGTTCTTTTAATGTTTTTATTTTTTATTCTGAATTTCAGTTGTTTCAAAATTGTATTCCTA[C/A]
TTGAACTCTGTTTTAGTTTTTCTAATTTTGGATATTATTATATTTTTATTCTAAATTTTAATTAATCTCGTATTGGATTCTTATATGGATTCTTCTTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 9.30% | 0.11% | 0.04% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.07% | 0.04% | NA |
| All Japonica | 1512 | 72.00% | 27.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.70% | 37.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622667500 | G -> T | LOC_Os06g38294.1 | upstream_gene_variant ; 2411.0bp to feature; MODIFIER | silent_mutation | Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 | N | N | N | N |
| vg0622667500 | G -> T | LOC_Os06g38294-LOC_Os06g38310 | intergenic_region ; MODIFIER | silent_mutation | Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 | N | N | N | N |
| vg0622667500 | G -> DEL | N | N | silent_mutation | Average:15.478; most accessible tissue: Minghui63 flag leaf, score: 26.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622667500 | NA | 1.01E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | NA | 5.87E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | NA | 9.33E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | NA | 6.26E-06 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | NA | 1.34E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | NA | 3.36E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | 9.50E-06 | 3.70E-08 | mr1786_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622667500 | 5.05E-08 | 2.04E-22 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |