\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622374528:

Variant ID: vg0622374528 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22374528
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.38, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AACATGATAGAGCATGATTTTAGAAATATTTAGAAAAAAGAATCATCTAATTTGGAGTTCATAGTTTTAAATTTTTGAAATTTTATTTTTGCATACGGCT[T/C]
CTTAAGTGGCCAGTATAAAAAAAAATAATTTTTCCATACGGGCGCTTAAGTGTCATTTTTACATGCGGTCCTCTTAAAAGACCCGTATGGGAAAATCGAT

Reverse complement sequence

ATCGATTTTCCCATACGGGTCTTTTAAGAGGACCGCATGTAAAAATGACACTTAAGCGCCCGTATGGAAAAATTATTTTTTTTTATACTGGCCACTTAAG[A/G]
AGCCGTATGCAAAAATAAAATTTCAAAAATTTAAAACTATGAACTCCAAATTAGATGATTCTTTTTTCTAAATATTTCTAAAATCATGCTCTATCATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.30% 0.04% 0.00% NA
All Indica  2759 68.80% 31.10% 0.07% 0.00% NA
All Japonica  1512 64.90% 35.10% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 85.20% 14.80% 0.00% 0.00% NA
Indica II  465 79.80% 20.20% 0.00% 0.00% NA
Indica III  913 48.40% 51.60% 0.00% 0.00% NA
Indica Intermediate  786 73.50% 26.20% 0.25% 0.00% NA
Temperate Japonica  767 39.90% 60.10% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 80.50% 19.50% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622374528 T -> C LOC_Os06g37800.1 downstream_gene_variant ; 3286.0bp to feature; MODIFIER silent_mutation Average:35.184; most accessible tissue: Callus, score: 55.656 N N N N
vg0622374528 T -> C LOC_Os06g37810.1 downstream_gene_variant ; 733.0bp to feature; MODIFIER silent_mutation Average:35.184; most accessible tissue: Callus, score: 55.656 N N N N
vg0622374528 T -> C LOC_Os06g37820.1 downstream_gene_variant ; 2138.0bp to feature; MODIFIER silent_mutation Average:35.184; most accessible tissue: Callus, score: 55.656 N N N N
vg0622374528 T -> C LOC_Os06g37800-LOC_Os06g37810 intergenic_region ; MODIFIER silent_mutation Average:35.184; most accessible tissue: Callus, score: 55.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622374528 NA 1.33E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 6.27E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 7.14E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 1.83E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 3.21E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 6.96E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 3.89E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 7.22E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 1.94E-06 1.94E-06 mr1966 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 4.83E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 4.31E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 1.42E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622374528 NA 9.87E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251