Variant ID: vg0622374528 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 22374528 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.61, T: 0.38, others allele: 0.00, population size: 103. )
AACATGATAGAGCATGATTTTAGAAATATTTAGAAAAAAGAATCATCTAATTTGGAGTTCATAGTTTTAAATTTTTGAAATTTTATTTTTGCATACGGCT[T/C]
CTTAAGTGGCCAGTATAAAAAAAAATAATTTTTCCATACGGGCGCTTAAGTGTCATTTTTACATGCGGTCCTCTTAAAAGACCCGTATGGGAAAATCGAT
ATCGATTTTCCCATACGGGTCTTTTAAGAGGACCGCATGTAAAAATGACACTTAAGCGCCCGTATGGAAAAATTATTTTTTTTTATACTGGCCACTTAAG[A/G]
AGCCGTATGCAAAAATAAAATTTCAAAAATTTAAAACTATGAACTCCAAATTAGATGATTCTTTTTTCTAAATATTTCTAAAATCATGCTCTATCATGTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.70% | 30.30% | 0.04% | 0.00% | NA |
All Indica | 2759 | 68.80% | 31.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 64.90% | 35.10% | 0.00% | 0.00% | NA |
Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
Indica II | 465 | 79.80% | 20.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 48.40% | 51.60% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 73.50% | 26.20% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 39.90% | 60.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0622374528 | T -> C | LOC_Os06g37800.1 | downstream_gene_variant ; 3286.0bp to feature; MODIFIER | silent_mutation | Average:35.184; most accessible tissue: Callus, score: 55.656 | N | N | N | N |
vg0622374528 | T -> C | LOC_Os06g37810.1 | downstream_gene_variant ; 733.0bp to feature; MODIFIER | silent_mutation | Average:35.184; most accessible tissue: Callus, score: 55.656 | N | N | N | N |
vg0622374528 | T -> C | LOC_Os06g37820.1 | downstream_gene_variant ; 2138.0bp to feature; MODIFIER | silent_mutation | Average:35.184; most accessible tissue: Callus, score: 55.656 | N | N | N | N |
vg0622374528 | T -> C | LOC_Os06g37800-LOC_Os06g37810 | intergenic_region ; MODIFIER | silent_mutation | Average:35.184; most accessible tissue: Callus, score: 55.656 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0622374528 | NA | 1.33E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 6.27E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 7.14E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 1.83E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 3.21E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 6.96E-06 | mr1528 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 3.89E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 7.22E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | 1.94E-06 | 1.94E-06 | mr1966 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 4.83E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 4.31E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 1.42E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0622374528 | NA | 9.87E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |