\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622302569:

Variant ID: vg0622302569 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22302569
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CATCGCCATCCTTTTACTTTCGTTCTATTTCGATGAGTTCTTACTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACTAGAGGTAAACTTGTCATGGC[G/A]
GTTTGCATTCTCGGGATTAGTGCTTCCATCTTTATGACACCCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATACTTCATAATCTTTATTAGTT

Reverse complement sequence

AACTAATAAAGATTATGAAGTATATATGATAACTCGACGAATTACATAAACAAGATTAGGGTGTCATAAAGATGGAAGCACTAATCCCGAGAATGCAAAC[C/T]
GCCATGACAAGTTTACCTCTAGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGTAAGAACTCATCGAAATAGAACGAAAGTAAAAGGATGGCGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.60% 0.08% 0.04% NA
All Indica  2759 76.30% 23.60% 0.11% 0.07% NA
All Japonica  1512 3.30% 96.70% 0.00% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 84.20% 15.80% 0.00% 0.00% NA
Indica II  465 86.20% 13.30% 0.43% 0.00% NA
Indica III  913 67.70% 32.20% 0.11% 0.00% NA
Indica Intermediate  786 74.30% 25.40% 0.00% 0.25% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622302569 G -> A LOC_Os06g37640.1 upstream_gene_variant ; 1539.0bp to feature; MODIFIER silent_mutation Average:51.599; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg0622302569 G -> A LOC_Os06g37650.1 upstream_gene_variant ; 2522.0bp to feature; MODIFIER silent_mutation Average:51.599; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg0622302569 G -> A LOC_Os06g37660.1 upstream_gene_variant ; 4553.0bp to feature; MODIFIER silent_mutation Average:51.599; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg0622302569 G -> A LOC_Os06g37640-LOC_Os06g37650 intergenic_region ; MODIFIER silent_mutation Average:51.599; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg0622302569 G -> DEL N N silent_mutation Average:51.599; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622302569 NA 3.84E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 6.83E-07 1.15E-11 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.40E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 4.09E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 1.05E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.43E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 5.64E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.45E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 3.35E-10 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 1.08E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 3.83E-09 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 5.64E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 9.17E-07 5.20E-12 mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 1.97E-06 3.58E-07 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 9.54E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 7.42E-06 2.78E-07 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.80E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.95E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 2.99E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 4.97E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 1.84E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302569 NA 1.78E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251