\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622302379:

Variant ID: vg0622302379 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22302379
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAATTAGGATATTTTAAATAGTTTCGTTAGAGATATGTTTAGGCAAAAGTCTGTCGTAAAGACTTATGTGTATCTTAGAGATTTAGAGATAAGAGTC[G/A]
TGTCCACCAAGGACATATCATGTATCTCGGGTATAAATATGACCCGAACCCATGTAATTAACAACAACAGTTCAATAACACTTTCGGCGCATCGCCATCC

Reverse complement sequence

GGATGGCGATGCGCCGAAAGTGTTATTGAACTGTTGTTGTTAATTACATGGGTTCGGGTCATATTTATACCCGAGATACATGATATGTCCTTGGTGGACA[C/T]
GACTCTTATCTCTAAATCTCTAAGATACACATAAGTCTTTACGACAGACTTTTGCCTAAACATATCTCTAACGAAACTATTTAAAATATCCTAATTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.90% 0.02% 0.00% NA
All Indica  2759 30.60% 69.40% 0.04% 0.00% NA
All Japonica  1512 85.40% 14.60% 0.00% 0.00% NA
Aus  269 74.00% 26.00% 0.00% 0.00% NA
Indica I  595 16.00% 84.00% 0.00% 0.00% NA
Indica II  465 20.40% 79.60% 0.00% 0.00% NA
Indica III  913 46.30% 53.70% 0.00% 0.00% NA
Indica Intermediate  786 29.30% 70.60% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 63.10% 36.90% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622302379 G -> A LOC_Os06g37640.1 upstream_gene_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:49.096; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0622302379 G -> A LOC_Os06g37650.1 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:49.096; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0622302379 G -> A LOC_Os06g37660.1 upstream_gene_variant ; 4743.0bp to feature; MODIFIER silent_mutation Average:49.096; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0622302379 G -> A LOC_Os06g37640-LOC_Os06g37650 intergenic_region ; MODIFIER silent_mutation Average:49.096; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622302379 NA 3.57E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 4.14E-08 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 9.46E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 1.85E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 1.42E-06 NA mr1289 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 1.60E-06 5.20E-06 mr1289 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 3.30E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 1.67E-11 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 7.18E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 5.11E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 5.43E-06 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 5.40E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 4.73E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 3.28E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 1.66E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 9.61E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 1.10E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 2.92E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 1.64E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 7.67E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622302379 NA 2.47E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251