| Variant ID: vg0622187287 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 22187287 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCATCCAGCACGCGACGGTGGACGGCGGCCCCGGCGACGGTGGGATCTTTCGCCTATCCAGAGTGGCCGGAGGCGGAAGCGGAAGATTGATACGTCAGAT[C/T]
TGGCACGAGCATCACCGCTGGAAACGAATCCACATTGGGCGGCAGCCTCTACACCTCAAAATCGCCGGTGAGTTCCCGACTGCTACCTCGTCCACGGCGC
GCGCCGTGGACGAGGTAGCAGTCGGGAACTCACCGGCGATTTTGAGGTGTAGAGGCTGCCGCCCAATGTGGATTCGTTTCCAGCGGTGATGCTCGTGCCA[G/A]
ATCTGACGTATCAATCTTCCGCTTCCGCCTCCGGCCACTCTGGATAGGCGAAAGATCCCACCGTCGCCGGGGCCGCCGTCCACCGTCGCGTGCTGGATGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 36.10% | 0.25% | 2.69% | NA |
| All Indica | 2759 | 87.70% | 10.80% | 0.14% | 1.27% | NA |
| All Japonica | 1512 | 6.90% | 90.50% | 0.40% | 2.12% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.00% | 0.34% | NA |
| Indica II | 465 | 94.80% | 3.00% | 0.22% | 1.94% | NA |
| Indica III | 913 | 75.00% | 22.50% | 0.33% | 2.19% | NA |
| Indica Intermediate | 786 | 89.70% | 9.80% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.70% | 79.20% | 1.19% | 4.96% | NA |
| Japonica Intermediate | 241 | 4.60% | 92.50% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 41.70% | 2.10% | 1.04% | 55.21% | NA |
| Intermediate | 90 | 60.00% | 31.10% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0622187287 | C -> T | LOC_Os06g37490.1 | upstream_gene_variant ; 3566.0bp to feature; MODIFIER | silent_mutation | Average:69.177; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0622187287 | C -> T | LOC_Os06g37500.1 | downstream_gene_variant ; 4746.0bp to feature; MODIFIER | silent_mutation | Average:69.177; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0622187287 | C -> T | LOC_Os06g37490-LOC_Os06g37500 | intergenic_region ; MODIFIER | silent_mutation | Average:69.177; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0622187287 | C -> DEL | N | N | silent_mutation | Average:69.177; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0622187287 | 3.61E-06 | 3.61E-06 | mr1012 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622187287 | NA | 1.01E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622187287 | NA | 1.65E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0622187287 | NA | 8.18E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |