Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0622173451:

Variant ID: vg0622173451 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22173451
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.05, T: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGCTACCATGAAACCTCTCACTATATATAATGGGTCGTAACCCACATCTATGATCAGTATAGGCTTCATCATAGATTAGTGGTTAGTGATTAGAAAAT[G/C]
TCATCCGTGAACACCTATAACTGATGTATCATTTGTAACGGATGCTAAGTCATGTATGACAGGTTAATAATTAGCACCTGTCGGGCCATCACTGATGACA

Reverse complement sequence

TGTCATCAGTGATGGCCCGACAGGTGCTAATTATTAACCTGTCATACATGACTTAGCATCCGTTACAAATGATACATCAGTTATAGGTGTTCACGGATGA[C/G]
ATTTTCTAATCACTAACCACTAATCTATGATGAAGCCTATACTGATCATAGATGTGGGTTACGACCCATTATATATAGTGAGAGGTTTCATGGTAGCGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.30%	19.50%	0.21%	59.99%	NA
All Indica	2759	6.90%	7.30%	0.18%	85.65%	NA
All Japonica	1512	45.20%	46.00%	0.13%	8.66%	NA
Aus	269	2.20%	1.90%	0.00%	95.91%	NA
Indica I	595	0.20%	1.00%	0.34%	98.49%	NA
Indica II	465	1.50%	3.70%	0.43%	94.41%	NA
Indica III	913	11.30%	13.40%	0.11%	75.25%	NA
Indica Intermediate	786	10.10%	7.10%	0.00%	82.82%	NA
Temperate Japonica	767	57.60%	40.00%	0.13%	2.22%	NA
Tropical Japonica	504	16.10%	62.90%	0.20%	20.83%	NA
Japonica Intermediate	241	66.80%	29.50%	0.00%	3.73%	NA
VI/Aromatic	96	61.50%	0.00%	0.00%	38.54%	NA
Intermediate	90	24.40%	21.10%	3.33%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622173451	G -> C	LOC_Os06g37480.1	upstream_gene_variant ; 2430.0bp to feature; MODIFIER	silent_mutation	Average:15.191; most accessible tissue: Callus, score: 91.847	N	N	N	N
vg0622173451	G -> C	LOC_Os06g37470.1	downstream_gene_variant ; 4467.0bp to feature; MODIFIER	silent_mutation	Average:15.191; most accessible tissue: Callus, score: 91.847	N	N	N	N
vg0622173451	G -> C	LOC_Os06g37480-LOC_Os06g37490	intergenic_region ; MODIFIER	silent_mutation	Average:15.191; most accessible tissue: Callus, score: 91.847	N	N	N	N
vg0622173451	G -> DEL	N	N	silent_mutation	Average:15.191; most accessible tissue: Callus, score: 91.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622173451	NA	2.51E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451	NA	2.80E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451	1.29E-06	NA	mr1125_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451	NA	2.44E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251