\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622173451:

Variant ID: vg0622173451 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22173451
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, G: 0.05, T: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGCTACCATGAAACCTCTCACTATATATAATGGGTCGTAACCCACATCTATGATCAGTATAGGCTTCATCATAGATTAGTGGTTAGTGATTAGAAAAT[G/C]
TCATCCGTGAACACCTATAACTGATGTATCATTTGTAACGGATGCTAAGTCATGTATGACAGGTTAATAATTAGCACCTGTCGGGCCATCACTGATGACA

Reverse complement sequence

TGTCATCAGTGATGGCCCGACAGGTGCTAATTATTAACCTGTCATACATGACTTAGCATCCGTTACAAATGATACATCAGTTATAGGTGTTCACGGATGA[C/G]
ATTTTCTAATCACTAACCACTAATCTATGATGAAGCCTATACTGATCATAGATGTGGGTTACGACCCATTATATATAGTGAGAGGTTTCATGGTAGCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.30% 19.50% 0.21% 59.99% NA
All Indica  2759 6.90% 7.30% 0.18% 85.65% NA
All Japonica  1512 45.20% 46.00% 0.13% 8.66% NA
Aus  269 2.20% 1.90% 0.00% 95.91% NA
Indica I  595 0.20% 1.00% 0.34% 98.49% NA
Indica II  465 1.50% 3.70% 0.43% 94.41% NA
Indica III  913 11.30% 13.40% 0.11% 75.25% NA
Indica Intermediate  786 10.10% 7.10% 0.00% 82.82% NA
Temperate Japonica  767 57.60% 40.00% 0.13% 2.22% NA
Tropical Japonica  504 16.10% 62.90% 0.20% 20.83% NA
Japonica Intermediate  241 66.80% 29.50% 0.00% 3.73% NA
VI/Aromatic  96 61.50% 0.00% 0.00% 38.54% NA
Intermediate  90 24.40% 21.10% 3.33% 51.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622173451 G -> C LOC_Os06g37480.1 upstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:15.191; most accessible tissue: Callus, score: 91.847 N N N N
vg0622173451 G -> C LOC_Os06g37470.1 downstream_gene_variant ; 4467.0bp to feature; MODIFIER silent_mutation Average:15.191; most accessible tissue: Callus, score: 91.847 N N N N
vg0622173451 G -> C LOC_Os06g37480-LOC_Os06g37490 intergenic_region ; MODIFIER silent_mutation Average:15.191; most accessible tissue: Callus, score: 91.847 N N N N
vg0622173451 G -> DEL N N silent_mutation Average:15.191; most accessible tissue: Callus, score: 91.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622173451 NA 2.51E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451 NA 2.80E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451 1.29E-06 NA mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622173451 NA 2.44E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251