Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0621418036:

Variant ID: vg0621418036 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 21418036
Reference Allele: C	Alternative Allele: T,CT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GACGTGGAACGTCGCCGCGACGCTCTGCTGCTGCCCGACGTAGTGGTGGCCGCCGCCGCCGCGCCGGTGGTCGTGCTCGTCGTCGTCGTGCTGCTGCTGC[C/T,CT]
GCCGCCGCTGATCAACCATAGCACTTTGGTGATCCGACGACGACGCTCCCATTCCCGCCTGTGTAGTTTAGATTAATAATTTATTAATTCAACATGTAAA

Reverse complement sequence

TTTACATGTTGAATTAATAAATTATTAATCTAAACTACACAGGCGGGAATGGGAGCGTCGTCGTCGGATCACCAAAGTGCTATGGTTGATCAGCGGCGGC[G/A,AG]
GCAGCAGCAGCACGACGACGACGAGCACGACCACCGGCGCGGCGGCGGCGGCCACCACTACGTCGGGCAGCAGCAGAGCGTCGCGGCGACGTTCCACGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.00%	0.53%	0.00%	CT: 0.04%
All Indica	2759	56.30%	43.10%	0.62%	0.00%	CT: 0.07%
All Japonica	1512	65.10%	34.50%	0.46%	0.00%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	94.10%	5.70%	0.17%	0.00%	NA
Indica II	465	69.20%	30.50%	0.22%	0.00%	NA
Indica III	913	24.80%	74.50%	0.55%	0.00%	CT: 0.22%
Indica Intermediate	786	56.50%	42.20%	1.27%	0.00%	NA
Temperate Japonica	767	51.80%	47.70%	0.52%	0.00%	NA
Tropical Japonica	504	81.90%	18.10%	0.00%	0.00%	NA
Japonica Intermediate	241	72.20%	26.60%	1.24%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0621418036	C -> T	LOC_Os06g36480.1	N	nonsynonymous_codon ; R344Q	Average:69.838; most accessible tissue: Zhenshan97 root, score: 82.549	unknown	unknown	TOLERATED	0.79
vg0621418036	C -> CT	LOC_Os06g36480.1	frameshift_variant ; p.Arg344fs; HIGH	frameshift_variant	Average:69.838; most accessible tissue: Zhenshan97 root, score: 82.549	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0621418036	NA	1.33E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	6.55E-06	6.55E-06	mr1327	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	2.63E-06	2.63E-06	mr1464	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	2.65E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	4.97E-06	4.97E-06	mr1756	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	2.15E-17	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	1.26E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	4.31E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	1.78E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0621418036	NA	2.43E-07	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251