\
| Variant ID: vg0621412586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21412586 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGCCGTCCCGTCAGGAGGATGTTCGGAGGACAACCGTGCAAATCTCCGTCCATTTATGAAGAGAAGAAAAGTCCAGTTTGGAAAGAGAGGGGTGCATGTG[G/C]
TATCCCCTTGAAGTATAAAAGGAGGACCCTGCCCATGGGGAAGGGGGATGATCTTTTCCAGATTCAGTAGCTAGAAGAAAAGGGGGAGGTTGGCTCACAC
GTGTGAGCCAACCTCCCCCTTTTCTTCTAGCTACTGAATCTGGAAAAGATCATCCCCCTTCCCCATGGGCAGGGTCCTCCTTTTATACTTCAAGGGGATA[C/G]
CACATGCACCCCTCTCTTTCCAAACTGGACTTTTCTTCTCTTCATAAATGGACGGAGATTTGCACGGTTGTCCTCCGAACATCCTCCTGACGGGACGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 0.30% | 5.18% | 11.43% | NA |
| All Indica | 2759 | 84.30% | 0.50% | 8.05% | 7.18% | NA |
| All Japonica | 1512 | 89.40% | 0.00% | 0.66% | 9.99% | NA |
| Aus | 269 | 27.90% | 0.00% | 2.97% | 69.14% | NA |
| Indica I | 595 | 80.20% | 0.80% | 13.78% | 5.21% | NA |
| Indica II | 465 | 84.70% | 0.40% | 6.88% | 7.96% | NA |
| Indica III | 913 | 87.60% | 0.20% | 3.83% | 8.32% | NA |
| Indica Intermediate | 786 | 83.20% | 0.60% | 9.29% | 6.87% | NA |
| Temperate Japonica | 767 | 81.70% | 0.00% | 0.78% | 17.47% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 0.79% | 0.79% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 0.00% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621412586 | G -> C | LOC_Os06g36470.1 | downstream_gene_variant ; 2263.0bp to feature; MODIFIER | silent_mutation | Average:26.751; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0621412586 | G -> C | LOC_Os06g36480.1 | downstream_gene_variant ; 1588.0bp to feature; MODIFIER | silent_mutation | Average:26.751; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0621412586 | G -> C | LOC_Os06g36470-LOC_Os06g36480 | intergenic_region ; MODIFIER | silent_mutation | Average:26.751; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| vg0621412586 | G -> DEL | N | N | silent_mutation | Average:26.751; most accessible tissue: Minghui63 root, score: 45.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621412586 | 3.09E-06 | NA | mr1184_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 5.26E-06 | 3.67E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 2.85E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 8.83E-06 | NA | mr1284_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 5.50E-06 | NA | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 3.12E-06 | 3.12E-06 | mr1374_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 5.05E-06 | 5.04E-06 | mr1412_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 7.25E-06 | 7.25E-06 | mr1412_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 9.89E-06 | mr1417_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 3.34E-06 | 3.34E-06 | mr1440_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 9.54E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 6.44E-06 | 3.93E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 8.06E-06 | 1.32E-06 | mr1747_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 2.41E-06 | 2.41E-06 | mr1747_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 3.30E-06 | NA | mr1811_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 7.50E-06 | 4.36E-06 | mr1811_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 2.45E-06 | 5.91E-06 | mr1816_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 4.26E-06 | 4.26E-06 | mr1816_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 2.65E-06 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | 3.52E-06 | 3.92E-06 | mr1831_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 3.50E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621412586 | NA | 4.69E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |