Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620988799:

Variant ID: vg0620988799 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20988799
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCACTAGCTCACATAATGGGATAATTACATTATTAGACATCTAGTATCTTGACGAGCTGCGTGCTTGAGACATCCGACCATGTTTCATTAGTCGTAACTA[C/T]
CCAACTAAATACGACTTAATGGTGGGCTGTGGGTGCATGGTTTTGCTAGTCGCACCCATGGCAATTAAGGACCGGTTCACAGGAAACCCTCGAAGACATA

Reverse complement sequence

TATGTCTTCGAGGGTTTCCTGTGAACCGGTCCTTAATTGCCATGGGTGCGACTAGCAAAACCATGCACCCACAGCCCACCATTAAGTCGTATTTAGTTGG[G/A]
TAGTTACGACTAATGAAACATGGTCGGATGTCTCAAGCACGCAGCTCGTCAAGATACTAGATGTCTAATAATGTAATTATCCCATTATGTGAGCTAGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	31.90%	0.72%	8.59%	NA
All Indica	2759	96.20%	1.10%	0.33%	2.36%	NA
All Japonica	1512	3.40%	95.20%	0.07%	1.26%	NA
Aus	269	7.80%	1.10%	4.46%	86.62%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	96.10%	1.30%	0.43%	2.15%	NA
Indica III	913	97.40%	0.20%	0.22%	2.19%	NA
Indica Intermediate	786	92.50%	2.40%	0.64%	4.45%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	92.30%	0.20%	3.17%	NA
Japonica Intermediate	241	3.70%	95.00%	0.00%	1.24%	NA
VI/Aromatic	96	6.20%	2.10%	9.38%	82.29%	NA
Intermediate	90	51.10%	34.40%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620988799	C -> T	LOC_Os06g35950-LOC_Os06g35960	intergenic_region ; MODIFIER	silent_mutation	Average:58.156; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0620988799	C -> DEL	N	N	silent_mutation	Average:58.156; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620988799	NA	1.14E-21	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	1.98E-30	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	4.85E-59	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	7.52E-56	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	6.54E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	3.48E-31	mr1181	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	2.33E-30	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	2.08E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	3.85E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	4.54E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	1.95E-27	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	4.18E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	6.45E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	3.19E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	1.64E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	1.50E-31	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	1.64E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	6.81E-17	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	5.43E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	5.11E-35	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	2.70E-31	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	5.38E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	4.07E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	8.42E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	2.86E-40	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799	NA	5.17E-24	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251