\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620988799:

Variant ID: vg0620988799 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20988799
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACTAGCTCACATAATGGGATAATTACATTATTAGACATCTAGTATCTTGACGAGCTGCGTGCTTGAGACATCCGACCATGTTTCATTAGTCGTAACTA[C/T]
CCAACTAAATACGACTTAATGGTGGGCTGTGGGTGCATGGTTTTGCTAGTCGCACCCATGGCAATTAAGGACCGGTTCACAGGAAACCCTCGAAGACATA

Reverse complement sequence

TATGTCTTCGAGGGTTTCCTGTGAACCGGTCCTTAATTGCCATGGGTGCGACTAGCAAAACCATGCACCCACAGCCCACCATTAAGTCGTATTTAGTTGG[G/A]
TAGTTACGACTAATGAAACATGGTCGGATGTCTCAAGCACGCAGCTCGTCAAGATACTAGATGTCTAATAATGTAATTATCCCATTATGTGAGCTAGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 31.90% 0.72% 8.59% NA
All Indica  2759 96.20% 1.10% 0.33% 2.36% NA
All Japonica  1512 3.40% 95.20% 0.07% 1.26% NA
Aus  269 7.80% 1.10% 4.46% 86.62% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.10% 1.30% 0.43% 2.15% NA
Indica III  913 97.40% 0.20% 0.22% 2.19% NA
Indica Intermediate  786 92.50% 2.40% 0.64% 4.45% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 92.30% 0.20% 3.17% NA
Japonica Intermediate  241 3.70% 95.00% 0.00% 1.24% NA
VI/Aromatic  96 6.20% 2.10% 9.38% 82.29% NA
Intermediate  90 51.10% 34.40% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620988799 C -> T LOC_Os06g35950-LOC_Os06g35960 intergenic_region ; MODIFIER silent_mutation Average:58.156; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0620988799 C -> DEL N N silent_mutation Average:58.156; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620988799 NA 1.14E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 1.98E-30 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 4.85E-59 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 7.52E-56 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 6.54E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 3.48E-31 mr1181 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 2.33E-30 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 2.08E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 3.85E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 4.54E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 1.95E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 4.18E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 6.45E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 3.19E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 1.64E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 1.50E-31 mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 1.64E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 6.81E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 5.43E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 5.11E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 2.70E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 5.38E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 4.07E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 8.42E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 2.86E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620988799 NA 5.17E-24 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251