Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0620772016:

Variant ID: vg0620772016 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20772016
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GTATTCCTCCGCGCCTGTATATAATCCTAAGTTAATTTCCTGGGGAGGGTATTCCTCCGTATTTAGCCCTAGTTGTATGGTCATCACGGGCTGTCGTAAG[G/A]
AACTCGGCAGTCAGGGGTGGCTTCTCGAAGTACCAGGAGAGCATCGGATAGAGGGTATTAGCTAGTATATCGGTTGACTAGAATGTATGTATATTATGTA

Reverse complement sequence

TACATAATATACATACATTCTAGTCAACCGATATACTAGCTAATACCCTCTATCCGATGCTCTCCTGGTACTTCGAGAAGCCACCCCTGACTGCCGAGTT[C/T]
CTTACGACAGCCCGTGATGACCATACAACTAGGGCTAAATACGGAGGAATACCCTCCCCAGGAAATTAACTTAGGATTATATACAGGCGCGGAGGAATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.00%	24.80%	0.15%	0.02%	NA
All Indica	2759	72.70%	27.00%	0.25%	0.00%	NA
All Japonica	1512	93.30%	6.70%	0.00%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	66.70%	33.10%	0.22%	0.00%	NA
Indica III	913	58.80%	40.70%	0.44%	0.00%	NA
Indica Intermediate	786	75.10%	24.70%	0.25%	0.00%	NA
Temperate Japonica	767	93.60%	6.40%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620772016	G -> A	LOC_Os06g35590.1	upstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:52.896; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0620772016	G -> A	LOC_Os06g35600.1	upstream_gene_variant ; 736.0bp to feature; MODIFIER	silent_mutation	Average:52.896; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0620772016	G -> A	LOC_Os06g35610.1	upstream_gene_variant ; 4748.0bp to feature; MODIFIER	silent_mutation	Average:52.896; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0620772016	G -> A	LOC_Os06g35590-LOC_Os06g35600	intergenic_region ; MODIFIER	silent_mutation	Average:52.896; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0620772016	G -> DEL	N	N	silent_mutation	Average:52.896; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620772016	NA	1.54E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	4.73E-06	3.71E-08	mr1567_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	NA	5.50E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	7.07E-06	7.07E-06	mr1806_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	NA	6.36E-07	mr1827_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	NA	1.60E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620772016	NA	9.74E-07	mr1842_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251