\
| Variant ID: vg0620693330 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20693330 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATAATGTAAGATAATTTCCACTTAAACCGATGTACTCATTACTTTGTACTATTATTTAAAAATAATGCACTATTTTAAAATAAAGTTTACACAATTATA[T/C]
TGTGCACCTATCAAATAAACAATTTAAGATCTATATACGTGCACTAAACCGATGGACCCATTATTTAAATCATCGTATCTATTTTTTATTACATTGGACT
AGTCCAATGTAATAAAAAATAGATACGATGATTTAAATAATGGGTCCATCGGTTTAGTGCACGTATATAGATCTTAAATTGTTTATTTGATAGGTGCACA[A/G]
TATAATTGTGTAAACTTTATTTTAAAATAGTGCATTATTTTTAAATAATAGTACAAAGTAATGAGTACATCGGTTTAAGTGGAAATTATCTTACATTATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 2.10% | 29.52% | 33.24% | NA |
| All Indica | 2759 | 3.30% | 3.10% | 40.16% | 53.46% | NA |
| All Japonica | 1512 | 93.70% | 0.00% | 1.98% | 4.30% | NA |
| Aus | 269 | 5.20% | 3.70% | 88.10% | 2.97% | NA |
| Indica I | 595 | 1.30% | 1.80% | 24.20% | 72.61% | NA |
| Indica II | 465 | 3.90% | 1.70% | 39.35% | 55.05% | NA |
| Indica III | 913 | 3.90% | 4.70% | 53.12% | 38.23% | NA |
| Indica Intermediate | 786 | 3.70% | 2.90% | 37.66% | 55.73% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 1.30% | 1.96% | NA |
| Tropical Japonica | 504 | 91.90% | 0.00% | 3.77% | 4.37% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.00% | 0.41% | 11.62% | NA |
| VI/Aromatic | 96 | 93.80% | 1.00% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 56.70% | 1.10% | 17.78% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620693330 | T -> C | LOC_Os06g35490.1 | upstream_gene_variant ; 1585.0bp to feature; MODIFIER | silent_mutation | Average:12.111; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0620693330 | T -> C | LOC_Os06g35490-LOC_Os06g35500 | intergenic_region ; MODIFIER | silent_mutation | Average:12.111; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0620693330 | T -> DEL | N | N | silent_mutation | Average:12.111; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620693330 | NA | 1.54E-56 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 7.29E-23 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 2.10E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 7.16E-78 | mr1033 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 6.51E-31 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 5.12E-34 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.76E-44 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.42E-57 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.15E-29 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 3.61E-28 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 5.29E-51 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 3.65E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 2.10E-40 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 4.98E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.12E-29 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 3.97E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 2.92E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 5.39E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 3.06E-41 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 4.77E-72 | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.82E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.99E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.79E-53 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 3.07E-71 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 4.35E-61 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 7.55E-21 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.10E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 9.51E-107 | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.91E-58 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 2.66E-26 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 4.14E-32 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.32E-68 | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.15E-36 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 5.51E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.32E-33 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 5.90E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 9.14E-40 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 1.44E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 4.09E-16 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 7.17E-15 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 6.95E-99 | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 6.34E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620693330 | NA | 8.10E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |