Search for Variation information by Variation ID:
Detailed information for vg0620513422:
| Variant ID: vg0620513422 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20513422 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CCTACTCGATTTCTTCGTGGGCAATTTCTTCGTGGGCAGACTGTTTGGACTAATAACCGCAGGAAACACTTCCCAGCGCACGGTCCAAGGTGCACTTAGC[G/A]
ACCAACTCGGAAACAATGTCGAGGCCTACGTCGATGACATTGTTGTCAAGACCAAGACAAGCGACTCATTGATTGACGATCTGCGGGAAACGTTAGACAA
Reverse complement sequence
TTGTCTAACGTTTCCCGCAGATCGTCAATCAATGAGTCGCTTGTCTTGGTCTTGACAACAATGTCATCGACGTAGGCCTCGACATTGTTTCCGAGTTGGT[C/T]
GCTAAGTGCACCTTGGACCGTGCGCTGGGAAGTGTTTCCTGCGGTTATTAGTCCAAACAGTCTGCCCACGAAGAAATTGCCCACGAAGAAATCGAGTAGG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 13.70% | 2.41% | 0.32% | NA |
| All Indica | 2759 | 98.90% | 0.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 51.90% | 39.90% | 7.21% | 0.99% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 80.70% | 16.40% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 12.30% | 78.40% | 8.93% | 0.40% | NA |
| Japonica Intermediate | 241 | 42.70% | 34.40% | 17.43% | 5.39% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620513422 | G -> A | LOC_Os06g35180.1 | missense_variant ; p.Asp228Asn; MODERATE | nonsynonymous_codon ; D228N | Average:9.002; most accessible tissue: Callus, score: 23.95 | benign  |
0.937 |
TOLERATED | 0.40 |
| vg0620513422 | G -> DEL | LOC_Os06g35180.1 | N | frameshift_variant | Average:9.002; most accessible tissue: Callus, score: 23.95 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620513422 | NA | 7.89E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | 4.08E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | 1.22E-06 | NA | mr1204 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 1.61E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 3.34E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 4.01E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 2.49E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | 7.50E-06 | NA | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 2.72E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 5.63E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620513422 | NA | 2.43E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |