\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620513422:

Variant ID: vg0620513422 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20513422
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACTCGATTTCTTCGTGGGCAATTTCTTCGTGGGCAGACTGTTTGGACTAATAACCGCAGGAAACACTTCCCAGCGCACGGTCCAAGGTGCACTTAGC[G/A]
ACCAACTCGGAAACAATGTCGAGGCCTACGTCGATGACATTGTTGTCAAGACCAAGACAAGCGACTCATTGATTGACGATCTGCGGGAAACGTTAGACAA

Reverse complement sequence

TTGTCTAACGTTTCCCGCAGATCGTCAATCAATGAGTCGCTTGTCTTGGTCTTGACAACAATGTCATCGACGTAGGCCTCGACATTGTTTCCGAGTTGGT[C/T]
GCTAAGTGCACCTTGGACCGTGCGCTGGGAAGTGTTTCCTGCGGTTATTAGTCCAAACAGTCTGCCCACGAAGAAATTGCCCACGAAGAAATCGAGTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 13.70% 2.41% 0.32% NA
All Indica  2759 98.90% 0.90% 0.14% 0.00% NA
All Japonica  1512 51.90% 39.90% 7.21% 0.99% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 98.10% 1.70% 0.25% 0.00% NA
Temperate Japonica  767 80.70% 16.40% 2.87% 0.00% NA
Tropical Japonica  504 12.30% 78.40% 8.93% 0.40% NA
Japonica Intermediate  241 42.70% 34.40% 17.43% 5.39% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620513422 G -> A LOC_Os06g35180.1 missense_variant ; p.Asp228Asn; MODERATE nonsynonymous_codon ; D228N Average:9.002; most accessible tissue: Callus, score: 23.95 benign 0.937 TOLERATED 0.40
vg0620513422 G -> DEL LOC_Os06g35180.1 N frameshift_variant Average:9.002; most accessible tissue: Callus, score: 23.95 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620513422 NA 7.89E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 4.08E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 1.22E-06 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 1.61E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 3.34E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 4.01E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 2.49E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 7.50E-06 NA mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 2.72E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 5.63E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620513422 NA 2.43E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251