\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620440814:

Variant ID: vg0620440814 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20440814
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCAAATTACCCCTAATCACTGTCTTAGTAAATTACTGATTTACCCTTAATAGTGAGCAATTCAGATCATTTTTACTGGTAGTGGTAGTATAATACTA[G/C]
CAATAGAGAGAACCAGAAGCATCGCTCAACATCATCTATTTAAGAACAAAATCAACATTGTAAAACATTATAAAAAAAAGAATGGAAGTAGCAGTTTATT

Reverse complement sequence

AATAAACTGCTACTTCCATTCTTTTTTTTATAATGTTTTACAATGTTGATTTTGTTCTTAAATAGATGATGTTGAGCGATGCTTCTGGTTCTCTCTATTG[C/G]
TAGTATTATACTACCACTACCAGTAAAAATGATCTGAATTGCTCACTATTAAGGGTAAATCAGTAATTTACTAAGACAGTGATTAGGGGTAATTTGGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 28.50% 12.61% 9.84% NA
All Indica  2759 71.80% 1.20% 14.68% 12.36% NA
All Japonica  1512 13.60% 84.80% 0.93% 0.66% NA
Aus  269 11.50% 0.00% 53.16% 35.32% NA
Indica I  595 85.90% 0.30% 8.24% 5.55% NA
Indica II  465 65.40% 2.80% 16.34% 15.48% NA
Indica III  913 63.50% 0.20% 19.93% 16.32% NA
Indica Intermediate  786 74.40% 2.00% 12.47% 11.07% NA
Temperate Japonica  767 7.80% 91.00% 0.39% 0.78% NA
Tropical Japonica  504 6.30% 90.90% 1.98% 0.79% NA
Japonica Intermediate  241 47.30% 52.30% 0.41% 0.00% NA
VI/Aromatic  96 61.50% 0.00% 27.08% 11.46% NA
Intermediate  90 48.90% 33.30% 8.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620440814 G -> C LOC_Os06g35130.1 downstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:40.051; most accessible tissue: Callus, score: 49.777 N N N N
vg0620440814 G -> C LOC_Os06g35120-LOC_Os06g35130 intergenic_region ; MODIFIER silent_mutation Average:40.051; most accessible tissue: Callus, score: 49.777 N N N N
vg0620440814 G -> DEL N N silent_mutation Average:40.051; most accessible tissue: Callus, score: 49.777 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620440814 NA 1.75E-38 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 1.28E-06 1.14E-57 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 9.47E-32 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.36E-28 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.72E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.33E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 3.96E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 6.04E-26 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 3.03E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 3.77E-16 mr1949 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 3.39E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 5.10E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 8.24E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 3.63E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.61E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.66E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.68E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.02E-13 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620440814 NA 1.62E-24 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251