\
| Variant ID: vg0620279439 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20279439 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGGTGTTGACGTGGTATGCCACAAACACGGACGTGACATGGCATCATCTTGACTGACAAATGGGACCGACTTAAAATTCATTTTCCTTTTTTCTTCTTT[C/T]
CTTCTCATTTTTCTCTCTCTTTTTTTCTTTTTTTCTCCTTTCTCTGTGACCCGAGCACCCCGTGCGGCGGTGGCCTACAGTTGTAGATAGAGAAAGGAGT
ACTCCTTTCTCTATCTACAACTGTAGGCCACCGCCGCACGGGGTGCTCGGGTCACAGAGAAAGGAGAAAAAAAGAAAAAAAGAGAGAGAAAAATGAGAAG[G/A]
AAAGAAGAAAAAAGGAAAATGAATTTTAAGTCGGTCCCATTTGTCAGTCAAGATGATGCCATGTCACGTCCGTGTTTGTGGCATACCACGTCAACACCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.00% | 18.50% | 2.71% | 50.85% | NA |
| All Indica | 2759 | 5.80% | 21.80% | 4.06% | 68.36% | NA |
| All Japonica | 1512 | 73.90% | 14.60% | 0.40% | 11.18% | NA |
| Aus | 269 | 3.00% | 2.60% | 0.74% | 93.68% | NA |
| Indica I | 595 | 10.60% | 44.40% | 4.37% | 40.67% | NA |
| Indica II | 465 | 5.80% | 27.30% | 6.88% | 60.00% | NA |
| Indica III | 913 | 1.30% | 3.00% | 1.64% | 94.09% | NA |
| Indica Intermediate | 786 | 7.40% | 23.30% | 4.96% | 64.38% | NA |
| Temperate Japonica | 767 | 83.20% | 8.70% | 0.39% | 7.69% | NA |
| Tropical Japonica | 504 | 79.00% | 6.00% | 0.40% | 14.68% | NA |
| Japonica Intermediate | 241 | 33.60% | 51.00% | 0.41% | 14.94% | NA |
| VI/Aromatic | 96 | 0.00% | 35.40% | 0.00% | 64.58% | NA |
| Intermediate | 90 | 40.00% | 13.30% | 8.89% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620279439 | C -> T | LOC_Os06g34870.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.586; most accessible tissue: Callus, score: 54.626 | N | N | N | N |
| vg0620279439 | C -> DEL | N | N | silent_mutation | Average:9.586; most accessible tissue: Callus, score: 54.626 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620279439 | NA | 2.25E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 2.62E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | 2.16E-07 | 1.51E-09 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | 1.22E-06 | 6.30E-09 | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 2.66E-08 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 4.21E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 2.71E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 3.84E-07 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 3.37E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 1.06E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 3.83E-07 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 1.67E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 8.45E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 2.67E-08 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 4.61E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620279439 | NA | 7.60E-12 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |