\
| Variant ID: vg0620278958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 20278958 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTGTTAGATAAATTCCCAGGTAACATATGAGTGTAGCTTTCATAAAGCTCACTTCAGATTGTTTATTTTCAAGATAGCTGAACGTCTGAACCGTCAACT[T/A]
GTCTCAAGTATGAGTCTGTAGTAGGTTTCAAATGTGAAGGTTTTACTATAGACTAGGAAGATCTAATTCCTATTTTCCAGTATTCTGCTTTGATTGCTAT
ATAGCAATCAAAGCAGAATACTGGAAAATAGGAATTAGATCTTCCTAGTCTATAGTAAAACCTTCACATTTGAAACCTACTACAGACTCATACTTGAGAC[A/T]
AGTTGACGGTTCAGACGTTCAGCTATCTTGAAAATAAACAATCTGAAGTGAGCTTTATGAAAGCTACACTCATATGTTACCTGGGAATTTATCTAACAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.30% | 13.10% | 1.25% | 50.34% | NA |
| All Indica | 2759 | 6.40% | 22.00% | 1.92% | 69.70% | NA |
| All Japonica | 1512 | 92.70% | 0.20% | 0.07% | 7.08% | NA |
| Aus | 269 | 3.70% | 2.20% | 1.12% | 92.94% | NA |
| Indica I | 595 | 10.30% | 44.70% | 1.85% | 43.19% | NA |
| Indica II | 465 | 6.90% | 28.00% | 1.51% | 63.66% | NA |
| Indica III | 913 | 2.00% | 3.10% | 1.75% | 93.21% | NA |
| Indica Intermediate | 786 | 8.40% | 23.20% | 2.42% | 66.03% | NA |
| Temperate Japonica | 767 | 93.60% | 0.10% | 0.00% | 6.26% | NA |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.20% | 6.35% | NA |
| Japonica Intermediate | 241 | 88.00% | 0.80% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 35.40% | 0.00% | 0.00% | 64.58% | NA |
| Intermediate | 90 | 53.30% | 3.30% | 2.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0620278958 | T -> A | LOC_Os06g34870.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.164; most accessible tissue: Callus, score: 23.133 | N | N | N | N |
| vg0620278958 | T -> DEL | N | N | silent_mutation | Average:6.164; most accessible tissue: Callus, score: 23.133 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0620278958 | 6.10E-06 | 1.22E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | 2.17E-06 | 1.48E-08 | mr1086 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 2.76E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 7.04E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 9.80E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | 5.72E-06 | NA | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 9.31E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | 5.25E-07 | 1.25E-07 | mr1226 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 9.89E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 5.60E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 3.50E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 1.49E-07 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0620278958 | NA | 6.59E-07 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |