\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620278958:

Variant ID: vg0620278958 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20278958
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGTTAGATAAATTCCCAGGTAACATATGAGTGTAGCTTTCATAAAGCTCACTTCAGATTGTTTATTTTCAAGATAGCTGAACGTCTGAACCGTCAACT[T/A]
GTCTCAAGTATGAGTCTGTAGTAGGTTTCAAATGTGAAGGTTTTACTATAGACTAGGAAGATCTAATTCCTATTTTCCAGTATTCTGCTTTGATTGCTAT

Reverse complement sequence

ATAGCAATCAAAGCAGAATACTGGAAAATAGGAATTAGATCTTCCTAGTCTATAGTAAAACCTTCACATTTGAAACCTACTACAGACTCATACTTGAGAC[A/T]
AGTTGACGGTTCAGACGTTCAGCTATCTTGAAAATAAACAATCTGAAGTGAGCTTTATGAAAGCTACACTCATATGTTACCTGGGAATTTATCTAACAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.30% 13.10% 1.25% 50.34% NA
All Indica  2759 6.40% 22.00% 1.92% 69.70% NA
All Japonica  1512 92.70% 0.20% 0.07% 7.08% NA
Aus  269 3.70% 2.20% 1.12% 92.94% NA
Indica I  595 10.30% 44.70% 1.85% 43.19% NA
Indica II  465 6.90% 28.00% 1.51% 63.66% NA
Indica III  913 2.00% 3.10% 1.75% 93.21% NA
Indica Intermediate  786 8.40% 23.20% 2.42% 66.03% NA
Temperate Japonica  767 93.60% 0.10% 0.00% 6.26% NA
Tropical Japonica  504 93.50% 0.00% 0.20% 6.35% NA
Japonica Intermediate  241 88.00% 0.80% 0.00% 11.20% NA
VI/Aromatic  96 35.40% 0.00% 0.00% 64.58% NA
Intermediate  90 53.30% 3.30% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620278958 T -> A LOC_Os06g34870.1 intron_variant ; MODIFIER silent_mutation Average:6.164; most accessible tissue: Callus, score: 23.133 N N N N
vg0620278958 T -> DEL N N silent_mutation Average:6.164; most accessible tissue: Callus, score: 23.133 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620278958 6.10E-06 1.22E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 2.17E-06 1.48E-08 mr1086 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 2.76E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 7.04E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 9.80E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 5.72E-06 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 9.31E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 5.25E-07 1.25E-07 mr1226 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 9.89E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 5.60E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 3.50E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 1.49E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958 NA 6.59E-07 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251