Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0620278958:

Variant ID: vg0620278958 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20278958
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGTTAGATAAATTCCCAGGTAACATATGAGTGTAGCTTTCATAAAGCTCACTTCAGATTGTTTATTTTCAAGATAGCTGAACGTCTGAACCGTCAACT[T/A]
GTCTCAAGTATGAGTCTGTAGTAGGTTTCAAATGTGAAGGTTTTACTATAGACTAGGAAGATCTAATTCCTATTTTCCAGTATTCTGCTTTGATTGCTAT

Reverse complement sequence

ATAGCAATCAAAGCAGAATACTGGAAAATAGGAATTAGATCTTCCTAGTCTATAGTAAAACCTTCACATTTGAAACCTACTACAGACTCATACTTGAGAC[A/T]
AGTTGACGGTTCAGACGTTCAGCTATCTTGAAAATAAACAATCTGAAGTGAGCTTTATGAAAGCTACACTCATATGTTACCTGGGAATTTATCTAACAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.30%	13.10%	1.25%	50.34%	NA
All Indica	2759	6.40%	22.00%	1.92%	69.70%	NA
All Japonica	1512	92.70%	0.20%	0.07%	7.08%	NA
Aus	269	3.70%	2.20%	1.12%	92.94%	NA
Indica I	595	10.30%	44.70%	1.85%	43.19%	NA
Indica II	465	6.90%	28.00%	1.51%	63.66%	NA
Indica III	913	2.00%	3.10%	1.75%	93.21%	NA
Indica Intermediate	786	8.40%	23.20%	2.42%	66.03%	NA
Temperate Japonica	767	93.60%	0.10%	0.00%	6.26%	NA
Tropical Japonica	504	93.50%	0.00%	0.20%	6.35%	NA
Japonica Intermediate	241	88.00%	0.80%	0.00%	11.20%	NA
VI/Aromatic	96	35.40%	0.00%	0.00%	64.58%	NA
Intermediate	90	53.30%	3.30%	2.22%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620278958	T -> A	LOC_Os06g34870.1	intron_variant ; MODIFIER	silent_mutation	Average:6.164; most accessible tissue: Callus, score: 23.133	N	N	N	N
vg0620278958	T -> DEL	N	N	silent_mutation	Average:6.164; most accessible tissue: Callus, score: 23.133	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620278958	6.10E-06	1.22E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	2.17E-06	1.48E-08	mr1086	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	2.76E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	7.04E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	9.80E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	5.72E-06	NA	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	9.31E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	5.25E-07	1.25E-07	mr1226	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	9.89E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	5.60E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	3.50E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	1.49E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620278958	NA	6.59E-07	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251