| Variant ID: vg0619934018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19934018 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCAGGCAAAGGGGCTCCGCAGTATCTGAACCAGCAAATCTTTTTTGGGCCAGAAGATGCCGAAGGAGTAATGTTCCCGCATCAAGATCCTCTGGTGATCT[T/C]
AGCCGAGCTAGCTGGTTTCGAGGTCCGGCGAATCCTGGTCGACGGGGGAAGTTCGGCCGATGTCATCTTGTTGATGAAAAAATCGAACACACCAGCCTGG
CCAGGCTGGTGTGTTCGATTTTTTCATCAACAAGATGACATCGGCCGAACTTCCCCCGTCGACCAGGATTCGCCGGACCTCGAAACCAGCTAGCTCGGCT[A/G]
AGATCACCAGAGGATCTTGATGCGGGAACATTACTCCTTCGGCATCTTCTGGCCCAAAAAAGATTTGCTGGTTCAGATACTGCGGAGCCCCTTTGCCTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 1.50% | 1.67% | 60.22% | NA |
| All Indica | 2759 | 8.50% | 0.70% | 2.43% | 88.37% | NA |
| All Japonica | 1512 | 95.80% | 0.50% | 0.07% | 3.70% | NA |
| Aus | 269 | 1.50% | 0.40% | 3.72% | 94.42% | NA |
| Indica I | 595 | 7.60% | 0.20% | 3.36% | 88.91% | NA |
| Indica II | 465 | 9.20% | 0.00% | 1.29% | 89.46% | NA |
| Indica III | 913 | 7.00% | 1.50% | 2.19% | 89.27% | NA |
| Indica Intermediate | 786 | 10.60% | 0.50% | 2.67% | 86.26% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.13% | 2.48% | NA |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.00% | 6.55% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.90% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 1.00% | 34.40% | 1.04% | 63.54% | NA |
| Intermediate | 90 | 47.80% | 11.10% | 0.00% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619934018 | T -> C | LOC_Os06g34230.1 | upstream_gene_variant ; 1942.0bp to feature; MODIFIER | silent_mutation | Average:11.815; most accessible tissue: Callus, score: 28.215 | N | N | N | N |
| vg0619934018 | T -> C | LOC_Os06g34240.1 | upstream_gene_variant ; 1500.0bp to feature; MODIFIER | silent_mutation | Average:11.815; most accessible tissue: Callus, score: 28.215 | N | N | N | N |
| vg0619934018 | T -> C | LOC_Os06g34230-LOC_Os06g34240 | intergenic_region ; MODIFIER | silent_mutation | Average:11.815; most accessible tissue: Callus, score: 28.215 | N | N | N | N |
| vg0619934018 | T -> DEL | N | N | silent_mutation | Average:11.815; most accessible tissue: Callus, score: 28.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619934018 | NA | 1.20E-07 | mr1059 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619934018 | 9.24E-06 | NA | mr1125 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619934018 | 5.93E-06 | 8.86E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619934018 | NA | 9.13E-06 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619934018 | NA | 9.14E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |