\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619861955:

Variant ID: vg0619861955 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19861955
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAACCTTATCATCCCTGTGTTTCTAATTTTATATTTTTTAAAAGTTATGTCAGTTGCTACTTCTAAATATTTTGTCACCCCTCATTTATTTGCTTCCTC[G/A]
ATCTACCACTACTTCTATTTGTTCTCACTAAAACCTCTAAAAATTAGACCTTATAGTTTTTAGAGTTTATTGTCTCGTTTGGGTTTTGTTTTTATAATTT

Reverse complement sequence

AAATTATAAAAACAAAACCCAAACGAGACAATAAACTCTAAAAACTATAAGGTCTAATTTTTAGAGGTTTTAGTGAGAACAAATAGAAGTAGTGGTAGAT[C/T]
GAGGAAGCAAATAAATGAGGGGTGACAAAATATTTAGAAGTAGCAACTGACATAACTTTTAAAAAATATAAAATTAGAAACACAGGGATGATAAGGTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 6.70% 1.12% 25.37% NA
All Indica  2759 56.50% 0.90% 1.59% 40.96% NA
All Japonica  1512 79.60% 19.10% 0.20% 1.06% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 76.50% 0.50% 0.84% 22.18% NA
Indica II  465 74.60% 0.40% 0.43% 24.52% NA
Indica III  913 31.30% 0.30% 2.85% 65.50% NA
Indica Intermediate  786 59.90% 2.30% 1.40% 36.39% NA
Temperate Japonica  767 70.40% 27.90% 0.00% 1.69% NA
Tropical Japonica  504 91.50% 8.30% 0.20% 0.00% NA
Japonica Intermediate  241 84.20% 13.70% 0.83% 1.24% NA
VI/Aromatic  96 60.40% 1.00% 2.08% 36.46% NA
Intermediate  90 77.80% 1.10% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619861955 G -> A LOC_Os06g34110.1 downstream_gene_variant ; 1083.0bp to feature; MODIFIER silent_mutation Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0619861955 G -> A LOC_Os06g34120.1 downstream_gene_variant ; 4115.0bp to feature; MODIFIER silent_mutation Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0619861955 G -> A LOC_Os06g34110-LOC_Os06g34120 intergenic_region ; MODIFIER silent_mutation Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0619861955 G -> DEL N N silent_mutation Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619861955 6.48E-07 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 1.92E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 6.09E-07 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 5.06E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 3.13E-07 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 5.27E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 7.44E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 3.24E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 3.96E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 4.13E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955 NA 3.01E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251