Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0619861955:

Variant ID: vg0619861955 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19861955
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAACCTTATCATCCCTGTGTTTCTAATTTTATATTTTTTAAAAGTTATGTCAGTTGCTACTTCTAAATATTTTGTCACCCCTCATTTATTTGCTTCCTC[G/A]
ATCTACCACTACTTCTATTTGTTCTCACTAAAACCTCTAAAAATTAGACCTTATAGTTTTTAGAGTTTATTGTCTCGTTTGGGTTTTGTTTTTATAATTT

Reverse complement sequence

AAATTATAAAAACAAAACCCAAACGAGACAATAAACTCTAAAAACTATAAGGTCTAATTTTTAGAGGTTTTAGTGAGAACAAATAGAAGTAGTGGTAGAT[C/T]
GAGGAAGCAAATAAATGAGGGGTGACAAAATATTTAGAAGTAGCAACTGACATAACTTTTAAAAAATATAAAATTAGAAACACAGGGATGATAAGGTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	6.70%	1.12%	25.37%	NA
All Indica	2759	56.50%	0.90%	1.59%	40.96%	NA
All Japonica	1512	79.60%	19.10%	0.20%	1.06%	NA
Aus	269	98.90%	0.00%	0.00%	1.12%	NA
Indica I	595	76.50%	0.50%	0.84%	22.18%	NA
Indica II	465	74.60%	0.40%	0.43%	24.52%	NA
Indica III	913	31.30%	0.30%	2.85%	65.50%	NA
Indica Intermediate	786	59.90%	2.30%	1.40%	36.39%	NA
Temperate Japonica	767	70.40%	27.90%	0.00%	1.69%	NA
Tropical Japonica	504	91.50%	8.30%	0.20%	0.00%	NA
Japonica Intermediate	241	84.20%	13.70%	0.83%	1.24%	NA
VI/Aromatic	96	60.40%	1.00%	2.08%	36.46%	NA
Intermediate	90	77.80%	1.10%	4.44%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619861955	G -> A	LOC_Os06g34110.1	downstream_gene_variant ; 1083.0bp to feature; MODIFIER	silent_mutation	Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0619861955	G -> A	LOC_Os06g34120.1	downstream_gene_variant ; 4115.0bp to feature; MODIFIER	silent_mutation	Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0619861955	G -> A	LOC_Os06g34110-LOC_Os06g34120	intergenic_region ; MODIFIER	silent_mutation	Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0619861955	G -> DEL	N	N	silent_mutation	Average:29.133; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619861955	6.48E-07	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	1.92E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	6.09E-07	NA	mr1140	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	5.06E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	3.13E-07	NA	mr1203	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	5.27E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	7.44E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	3.24E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	3.96E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	4.13E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619861955	NA	3.01E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251