Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619658716:

Variant ID: vg0619658716 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19658716
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCAAAAAGTTACATCGACCCTCTTATAGGGTATATACAGGAGTGCATAGGAGATAGAGACTTGTAGTACAATATAAGTAAGAGTAGATTTACCTCTAG[G/A]
ATTCTATCTTTAGAACTCTATTTTATCTCTAGGATTGTATCTTATCTCTATATTCGTATTTAATTCTTATCTCTAACTAACATATGTGTACTTTTAACAA

Reverse complement sequence

TTGTTAAAAGTACACATATGTTAGTTAGAGATAAGAATTAAATACGAATATAGAGATAAGATACAATCCTAGAGATAAAATAGAGTTCTAAAGATAGAAT[C/T]
CTAGAGGTAAATCTACTCTTACTTATATTGTACTACAAGTCTCTATCTCCTATGCACTCCTGTATATACCCTATAAGAGGGTCGATGTAACTTTTTGCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	32.30%	0.02%	1.99%	NA
All Indica	2759	97.40%	2.50%	0.00%	0.07%	NA
All Japonica	1512	6.00%	93.70%	0.07%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.10%	0.80%	0.00%	0.11%	NA
Indica Intermediate	786	95.80%	4.10%	0.00%	0.13%	NA
Temperate Japonica	767	3.50%	96.30%	0.13%	0.00%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	96.70%	0.00%	1.24%	NA
VI/Aromatic	96	11.50%	3.10%	0.00%	85.42%	NA
Intermediate	90	50.00%	42.20%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619658716	G -> A	LOC_Os06g33800.1	upstream_gene_variant ; 2499.0bp to feature; MODIFIER	silent_mutation	Average:58.748; most accessible tissue: Callus, score: 89.37	N	N	N	N
vg0619658716	G -> A	LOC_Os06g33810.1	upstream_gene_variant ; 4511.0bp to feature; MODIFIER	silent_mutation	Average:58.748; most accessible tissue: Callus, score: 89.37	N	N	N	N
vg0619658716	G -> A	LOC_Os06g33790.1	downstream_gene_variant ; 4188.0bp to feature; MODIFIER	silent_mutation	Average:58.748; most accessible tissue: Callus, score: 89.37	N	N	N	N
vg0619658716	G -> A	LOC_Os06g33790-LOC_Os06g33800	intergenic_region ; MODIFIER	silent_mutation	Average:58.748; most accessible tissue: Callus, score: 89.37	N	N	N	N
vg0619658716	G -> DEL	N	N	silent_mutation	Average:58.748; most accessible tissue: Callus, score: 89.37	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619658716	4.22E-09	1.88E-79	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	4.25E-07	NA	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	4.94E-07	4.94E-07	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.00E-77	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.32E-35	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.03E-89	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	7.89E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	9.64E-42	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	9.53E-96	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	2.18E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	3.35E-89	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	9.19E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.49E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.46E-74	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	7.22E-08	7.22E-08	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	8.24E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	3.45E-06	3.45E-06	mr1542	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	5.29E-92	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.61E-66	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	2.91E-36	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	6.77E-61	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	8.14E-10	8.99E-112	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.25E-31	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	3.87E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	1.04E-38	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	7.39E-98	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716	NA	3.20E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251