\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619658716:

Variant ID: vg0619658716 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19658716
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCAAAAAGTTACATCGACCCTCTTATAGGGTATATACAGGAGTGCATAGGAGATAGAGACTTGTAGTACAATATAAGTAAGAGTAGATTTACCTCTAG[G/A]
ATTCTATCTTTAGAACTCTATTTTATCTCTAGGATTGTATCTTATCTCTATATTCGTATTTAATTCTTATCTCTAACTAACATATGTGTACTTTTAACAA

Reverse complement sequence

TTGTTAAAAGTACACATATGTTAGTTAGAGATAAGAATTAAATACGAATATAGAGATAAGATACAATCCTAGAGATAAAATAGAGTTCTAAAGATAGAAT[C/T]
CTAGAGGTAAATCTACTCTTACTTATATTGTACTACAAGTCTCTATCTCCTATGCACTCCTGTATATACCCTATAAGAGGGTCGATGTAACTTTTTGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 32.30% 0.02% 1.99% NA
All Indica  2759 97.40% 2.50% 0.00% 0.07% NA
All Japonica  1512 6.00% 93.70% 0.07% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.80% 0.00% 0.11% NA
Indica Intermediate  786 95.80% 4.10% 0.00% 0.13% NA
Temperate Japonica  767 3.50% 96.30% 0.13% 0.00% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 96.70% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 3.10% 0.00% 85.42% NA
Intermediate  90 50.00% 42.20% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619658716 G -> A LOC_Os06g33800.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:58.748; most accessible tissue: Callus, score: 89.37 N N N N
vg0619658716 G -> A LOC_Os06g33810.1 upstream_gene_variant ; 4511.0bp to feature; MODIFIER silent_mutation Average:58.748; most accessible tissue: Callus, score: 89.37 N N N N
vg0619658716 G -> A LOC_Os06g33790.1 downstream_gene_variant ; 4188.0bp to feature; MODIFIER silent_mutation Average:58.748; most accessible tissue: Callus, score: 89.37 N N N N
vg0619658716 G -> A LOC_Os06g33790-LOC_Os06g33800 intergenic_region ; MODIFIER silent_mutation Average:58.748; most accessible tissue: Callus, score: 89.37 N N N N
vg0619658716 G -> DEL N N silent_mutation Average:58.748; most accessible tissue: Callus, score: 89.37 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619658716 4.22E-09 1.88E-79 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 4.25E-07 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 4.94E-07 4.94E-07 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.00E-77 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.32E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.03E-89 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 7.89E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 9.64E-42 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 9.53E-96 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 2.18E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 3.35E-89 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 9.19E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.49E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.46E-74 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 7.22E-08 7.22E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 8.24E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 3.45E-06 3.45E-06 mr1542 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 5.29E-92 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.61E-66 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 2.91E-36 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 6.77E-61 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 8.14E-10 8.99E-112 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.25E-31 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 3.87E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 1.04E-38 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 7.39E-98 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619658716 NA 3.20E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251