\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619432377:

Variant ID: vg0619432377 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 19432377
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTCTATGTCATGACGATGATATTAGAGTAGTATCTGGCAGTTTAGGCGTGGTGTCTAGATTACGGGATATCATTATTTGGGGTTATTATATTGTGGAT[A/G]
AGAGGTGGGCCGCTGATGGTGACAGCTCAGTACGGGTATTCCTCTGCGCCTATATATAATCCTAAGTTAATTTCCTGGGAGGGTATTTCTCCGTATTTAG

Reverse complement sequence

CTAAATACGGAGAAATACCCTCCCAGGAAATTAACTTAGGATTATATATAGGCGCAGAGGAATACCCGTACTGAGCTGTCACCATCAGCGGCCCACCTCT[T/C]
ATCCACAATATAATAACCCCAAATAATGATATCCCGTAATCTAGACACCACGCCTAAACTGCCAGATACTACTCTAATATCATCGTCATGACATAGAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 32.40% 1.50% 17.01% NA
All Indica  2759 77.30% 3.00% 1.81% 17.94% NA
All Japonica  1512 4.20% 93.50% 0.26% 2.12% NA
Aus  269 29.00% 0.70% 3.35% 66.91% NA
Indica I  595 79.80% 3.40% 0.50% 16.30% NA
Indica II  465 94.20% 3.40% 0.22% 2.15% NA
Indica III  913 73.10% 1.00% 2.85% 23.11% NA
Indica Intermediate  786 70.20% 4.70% 2.54% 22.52% NA
Temperate Japonica  767 3.30% 96.50% 0.13% 0.13% NA
Tropical Japonica  504 6.30% 88.10% 0.20% 5.36% NA
Japonica Intermediate  241 2.50% 95.00% 0.83% 1.66% NA
VI/Aromatic  96 6.20% 3.10% 3.12% 87.50% NA
Intermediate  90 46.70% 33.30% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0619432377 A -> G LOC_Os06g33350.1 upstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:43.629; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0619432377 A -> G LOC_Os06g33360.1 upstream_gene_variant ; 2445.0bp to feature; MODIFIER silent_mutation Average:43.629; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0619432377 A -> G LOC_Os06g33350-LOC_Os06g33360 intergenic_region ; MODIFIER silent_mutation Average:43.629; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0619432377 A -> DEL N N silent_mutation Average:43.629; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0619432377 4.04E-06 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 6.37E-07 6.37E-07 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 8.10E-06 8.10E-06 mr1108 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 6.73E-07 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 1.15E-07 1.15E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 1.11E-12 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 2.86E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 3.31E-07 3.31E-07 mr1973 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 1.34E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 5.59E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 1.36E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 1.06E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 9.31E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 4.15E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619432377 NA 3.32E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251