Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0619386162:

Variant ID: vg0619386162 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 19386162
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGATAACGACACTCAATTCACTAGCGGAGTATTTAAAGATTTCTGTGAGGACTTCGGCATCAAAATTTGTTATGCCTCCATAGCGCACCACATGAGCAA[C/T]
AGACAAGTCGAACGTGCCAATGGTATGGTACTTCAAGGAATAAAAGCACGAGTTTTCGACCGACTGCATCCCTATGCCGGCAAGTGGGTAGAACAGCTGC

Reverse complement sequence

GCAGCTGTTCTACCCACTTGCCGGCATAGGGATGCAGTCGGTCGAAAACTCGTGCTTTTATTCCTTGAAGTACCATACCATTGGCACGTTCGACTTGTCT[G/A]
TTGCTCATGTGGTGCGCTATGGAGGCATAACAAATTTTGATGCCGAAGTCCTCACAGAAATCTTTAAATACTCCGCTAGTGAATTGAGTGTCGTTATCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	36.60%	0.02%	0.47%	NA
All Indica	2759	93.00%	6.40%	0.00%	0.58%	NA
All Japonica	1512	5.80%	94.00%	0.00%	0.20%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	92.90%	6.40%	0.00%	0.67%	NA
Indica II	465	94.40%	4.90%	0.00%	0.65%	NA
Indica III	913	96.30%	3.40%	0.00%	0.33%	NA
Indica Intermediate	786	88.50%	10.70%	0.00%	0.76%	NA
Temperate Japonica	767	3.30%	96.50%	0.00%	0.26%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.00%	0.41%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	50.00%	45.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0619386162	C -> T	LOC_Os06g33290.1	downstream_gene_variant ; 358.0bp to feature; MODIFIER	silent_mutation	Average:32.204; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0619386162	C -> T	LOC_Os06g33300.1	downstream_gene_variant ; 889.0bp to feature; MODIFIER	silent_mutation	Average:32.204; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0619386162	C -> T	LOC_Os06g33310.1	downstream_gene_variant ; 3149.0bp to feature; MODIFIER	silent_mutation	Average:32.204; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0619386162	C -> T	LOC_Os06g33290-LOC_Os06g33300	intergenic_region ; MODIFIER	silent_mutation	Average:32.204; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0619386162	C -> DEL	N	N	silent_mutation	Average:32.204; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0619386162	1.19E-09	6.08E-79	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	1.80E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	2.22E-07	NA	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	2.11E-06	2.16E-44	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	9.54E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	2.57E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	6.99E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	1.71E-09	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	7.20E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	5.89E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	1.69E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	3.50E-11	2.12E-103	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	4.20E-08	NA	mr1033_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	4.57E-06	NA	mr1410_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	1.48E-06	NA	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	4.71E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0619386162	NA	3.21E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251