\
| Variant ID: vg0619257211 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 19257211 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCCAACTCACCCTAGGCTAGCGGAGACCAACACCTCTGACGGCCTTCTAGTAACTTGCCCGTCAGAGGTGGATGTCACCTGTGACGGCCGGCCACCCGT[T/C]
AAAGGTGACTGGACTCACCAGTGACCACTGATCACTGACCATGCGTGAAGCCGTCAAAGATGATGGTTTGGGTCCGTGACAGGTGACCTTGGCCAGTGTA
TACACTGGCCAAGGTCACCTGTCACGGACCCAAACCATCATCTTTGACGGCTTCACGCATGGTCAGTGATCAGTGGTCACTGGTGAGTCCAGTCACCTTT[A/G]
ACGGGTGGCCGGCCGTCACAGGTGACATCCACCTCTGACGGGCAAGTTACTAGAAGGCCGTCAGAGGTGTTGGTCTCCGCTAGCCTAGGGTGAGTTGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 26.10% | 0.21% | 6.22% | NA |
| All Indica | 2759 | 96.60% | 3.00% | 0.07% | 0.36% | NA |
| All Japonica | 1512 | 6.60% | 74.40% | 0.46% | 18.52% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 2.70% | 0.17% | 1.34% | NA |
| Indica II | 465 | 95.50% | 4.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 4.80% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 3.70% | 67.70% | 0.91% | 27.77% | NA |
| Tropical Japonica | 504 | 11.70% | 84.90% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 5.40% | 73.90% | 0.00% | 20.75% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0619257211 | T -> C | LOC_Os06g33080.1 | downstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:56.08; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0619257211 | T -> C | LOC_Os06g33070.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.08; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0619257211 | T -> DEL | N | N | silent_mutation | Average:56.08; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0619257211 | 2.56E-09 | 3.04E-76 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | 1.03E-06 | NA | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 1.47E-76 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 4.69E-36 | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 6.04E-91 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | 9.16E-06 | 3.85E-40 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 6.80E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 8.62E-89 | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 5.04E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 1.13E-17 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | 9.83E-06 | NA | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 6.40E-29 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 1.64E-65 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | NA | 5.77E-06 | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | 4.21E-10 | 3.48E-104 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0619257211 | 4.38E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |